Merge branch 'master' of https://github.com/nf-core/modules into rhocall

modules/bamtools/convert/meta.yml

@@ -42,7 +42,6 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-  ## TODO nf-core: Delete / customise this example output
   - out:
       type: file
       description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml)

modules/bcftools/concat/main.nf

@@ -8,7 +8,7 @@ process BCFTOOLS_CONCAT {
         'quay.io/biocontainers/bcftools:1.14--h88f3f91_0' }"
 
     input:
-    tuple val(meta), path(vcfs)
+    tuple val(meta), path(vcfs), path(tbi)
 
     output:
     tuple val(meta), path("*.gz"), emit: vcf

modules/bcftools/concat/meta.yml

@@ -25,6 +25,11 @@ input:
       description: |
         List containing 2 or more vcf files
         e.g. [ 'file1.vcf', 'file2.vcf' ]
+  - tbi:
+      type: files
+      description: |
+        List containing 2 or more index files (optional)
+        e.g. [ 'file1.tbi', 'file2.tbi' ]
 output:
   - meta:
       type: map

modules/cnvkit/batch/main.nf

@@ -10,6 +10,7 @@ process CNVKIT_BATCH {
     input:
     tuple val(meta), path(tumor), path(normal)
     path  fasta
+    path  fasta_fai
     path  targets
     path  reference
 
@@ -28,48 +29,167 @@ process CNVKIT_BATCH {
     script:
     def args = task.ext.args ?: ''
 
-    // execute samtools only when cram files are input, cnvkit runs natively on bam but is prohibitively slow
+    def tumor_exists = tumor ? true : false
-    // input pair is assumed to have same extension if both exist
+    def normal_exists = normal ? true : false
-    def is_cram = tumor.Extension == "cram" ? true : false
+
-    def tumor_out = is_cram ? tumor.BaseName + ".bam" : "${tumor}"
+    // execute samtools only when cram files are input, cnvkit runs natively on bam but is prohibitively slow
+    def tumor_cram = tumor_exists && tumor.Extension == "cram" ? true : false
+    def normal_cram = normal_exists && normal.Extension == "cram" ? true : false
+    def tumor_bam = tumor_exists && tumor.Extension == "bam" ? true : false
+    def normal_bam = normal_exists && normal.Extension == "bam" ? true : false
+
+    def tumor_out = tumor_cram ? tumor.BaseName + ".bam" : "${tumor}"
 
-    // do not run samtools on normal samples in tumor_only mode
-    def normal_exists = normal ? true: false
     // tumor_only mode does not need fasta & target
     // instead it requires a pre-computed reference.cnn which is built from fasta & target
     def (normal_out, normal_args, fasta_args) = ["", "", ""]
+    def fai_reference = fasta_fai ? "--fai-reference ${fasta_fai}" : ""
 
     if (normal_exists){
         def normal_prefix = normal.BaseName
-        normal_out = is_cram ? "${normal_prefix}" + ".bam" : "${normal}"
+        normal_out = normal_cram ? "${normal_prefix}" + ".bam" : "${normal}"
-        normal_args = normal_prefix ? "--normal $normal_out" : ""
         fasta_args = fasta ? "--fasta $fasta" : ""
+
+        // germline mode
+        // normal samples must be input without a flag
+        // requires flag --normal to be empty []
+        if(!tumor_exists){
+            tumor_out = "${normal_prefix}" + ".bam"
+            normal_args = "--normal "
+        }
+        // somatic mode
+        else {
+            normal_args = normal_prefix ? "--normal $normal_out" : ""
+        }
     }
 
     def target_args = targets ? "--targets $targets" : ""
     def reference_args = reference ? "--reference $reference" : ""
 
-    """
+    // somatic_mode cram_input
-    if $is_cram; then
+    if (tumor_cram && normal_cram){
-        samtools view -T $fasta $tumor -@ $task.cpus -o $tumor_out
+        """
-        if $normal_exists; then
+        samtools view -T $fasta $fai_reference $tumor -@ $task.cpus -o $tumor_out
-            samtools view -T $fasta $normal -@ $task.cpus -o $normal_out
+        samtools view -T $fasta $fai_reference $normal -@ $task.cpus -o $normal_out
-        fi
-    fi
 
-    cnvkit.py \\
+        cnvkit.py \\
-        batch \\
+            batch \\
-        $tumor_out \\
+            $tumor_out \\
-        $normal_args \\
+            $normal_args \\
-        $fasta_args \\
+            $fasta_args \\
-        $reference_args \\
+            $reference_args \\
-        $target_args \\
+            $target_args \\
-        --processes $task.cpus \\
+            --processes $task.cpus \\
-        $args
+            $args
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+            cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
+        END_VERSIONS
+        """
+    }
+    // somatic_mode bam_input
+    else if (tumor_bam && normal_bam){
+        """
+        cnvkit.py \\
+            batch \\
+            $tumor_out \\
+            $normal_args \\
+            $fasta_args \\
+            $reference_args \\
+            $target_args \\
+            --processes $task.cpus \\
+            $args
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
+        END_VERSIONS
+        """
+    }
+    // tumor_only_mode cram_input
+    else if(tumor_cram && !normal_exists){
+        """
+        samtools view -T $fasta $fai_reference $tumor -@ $task.cpus -o $tumor_out
+
+        cnvkit.py \\
+            batch \\
+            $tumor_out \\
+            $normal_args \\
+            $fasta_args \\
+            $reference_args \\
+            $target_args \\
+            --processes $task.cpus \\
+            $args
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+            cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
+        END_VERSIONS
+        """
+    }
+    // tumor_only bam_input
+    else if(tumor_bam && !normal_exists){
+        """
+        cnvkit.py \\
+            batch \\
+            $tumor_out \\
+            $normal_args \\
+            $fasta_args \\
+            $reference_args \\
+            $target_args \\
+            --processes $task.cpus \\
+            $args
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
+        END_VERSIONS
+        """
+    }
+    // germline mode cram_input
+    // normal_args must be --normal []
+    else if (normal_cram && !tumor_exists){
+        """
+        samtools view -T $fasta $fai_reference $normal -@ $task.cpus -o $tumor_out
+
+        cnvkit.py \\
+            batch \\
+            $tumor_out \\
+            $normal_args \\
+            $fasta_args \\
+            $reference_args \\
+            $target_args \\
+            --processes $task.cpus \\
+            $args
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+            cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
+        END_VERSIONS
+        """
+    }
+    // germline mode bam_input
+    else if (normal_bam && !tumor_exists){
+        """
+        cnvkit.py \\
+            batch \\
+            $tumor_out \\
+            $normal_args \\
+            $fasta_args \\
+            $reference_args \\
+            $target_args \\
+            --processes $task.cpus \\
+            $args
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
+        END_VERSIONS
+        """
+    }
 
-    cat <<-END_VERSIONS > versions.yml
-    "${task.process}":
-        cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
-    END_VERSIONS
-    """
 }

modules/cnvkit/batch/meta.yml

@@ -29,6 +29,10 @@ input:
       type: file
       description: |
         Input reference genome fasta file (only needed for cram_input and/or when normal_samples are provided)
+  - fasta_fai:
+      type: file
+      description: |
+        Input reference genome fasta index (optional, but recommended for cram_input)
   - targetfile:
       type: file
       description: |

modules/deeptools/bamcoverage/main.nf

@@ -2,13 +2,15 @@ process DEEPTOOLS_BAMCOVERAGE {
     tag "$meta.id"
     label 'process_low'
 
-    conda (params.enable_conda ? "bioconda::deeptools=3.5.1" : null)
+    conda (params.enable_conda ? "bioconda::deeptools=3.5.1 bioconda::samtools=1.15.1" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/deeptools:3.5.1--py_0':
+        'https://depot.galaxyproject.org/singularity/mulled-v2-eb9e7907c7a753917c1e4d7a64384c047429618a:2c687053c0252667cca265c9f4118f2c205a604c-0':
-        'quay.io/biocontainers/deeptools:3.5.1--py_0' }"
+        'quay.io/biocontainers/mulled-v2-eb9e7907c7a753917c1e4d7a64384c047429618a:2c687053c0252667cca265c9f4118f2c205a604c-0' }"
 
     input:
     tuple val(meta), path(input), path(input_index)
+    path(fasta)
+    path(fasta_fai)
 
     output:
     tuple val(meta), path("*.bigWig")   , emit: bigwig, optional: true
@@ -22,16 +24,44 @@ process DEEPTOOLS_BAMCOVERAGE {
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}.bigWig"
 
-    """
+    // cram_input is currently not working with deeptools
-    bamCoverage \\
+    // therefore it's required to convert cram to bam first
-        --bam $input \\
+    def is_cram = input.Extension == "cram" ? true : false
-        $args \\
+    def input_out = is_cram ? input.BaseName + ".bam" : "${input}"
-        --numberOfProcessors ${task.cpus} \\
+    def fai_reference = fasta_fai ? "--fai-reference ${fasta_fai}" : ""
-        --outFileName ${prefix}
+
+    if (is_cram){
+        """
+        samtools view -T $fasta $input $fai_reference -@ $task.cpus -o $input_out
+        samtools index -b $input_out -@ $task.cpus
+
+        bamCoverage \\
+            --bam $input_out \\
+            $args \\
+            --numberOfProcessors ${task.cpus} \\
+            --outFileName ${prefix}
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+            deeptools: \$(bamCoverage --version | sed -e "s/bamCoverage //g")
+        END_VERSIONS
+        """
+
+    }
+    else {
+        """
+        bamCoverage \\
+            --bam $input_out \\
+            $args \\
+            --numberOfProcessors ${task.cpus} \\
+            --outFileName ${prefix}
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            deeptools: \$(bamCoverage --version | sed -e "s/bamCoverage //g")
+        END_VERSIONS
+        """
+    }
 
-    cat <<-END_VERSIONS > versions.yml
-    "${task.process}":
-        deeptools: \$(bamCoverage --version | sed -e "s/bamCoverage //g")
-    END_VERSIONS
-    """
 }

modules/deeptools/bamcoverage/meta.yml

@@ -25,6 +25,14 @@ input:
       type: file
       description: BAM/CRAM index file
       pattern: "*.{bai,crai}"
+  - fasta:
+      type: file
+      description: Reference file the CRAM file was created with (required with CRAM input)
+      pattern: "*.{fasta,fa}"
+  - fasta_fai:
+      type: file
+      description: Index of the reference file (optional, but recommended)
+      pattern: "*.{fai}"
 
 output:
   - meta:
@@ -47,3 +55,4 @@ output:
 
 authors:
   - "@FriederikeHanssen"
+  - "@SusiJo"

modules/ensemblvep/Dockerfile

@@ -11,8 +11,8 @@ RUN conda env create -f /environment.yml && conda clean -a
 # Setup default ARG variables
 ARG GENOME=GRCh38
 ARG SPECIES=homo_sapiens
-ARG VEP_VERSION=104
+ARG VEP_VERSION=105
-ARG VEP_TAG=104.3
+ARG VEP_TAG=105.0
 
 # Add conda installation dir to PATH (instead of doing 'conda activate')
 ENV PATH /opt/conda/envs/nf-core-vep-${VEP_TAG}/bin:$PATH

modules/ensemblvep/build.sh

@@ -20,9 +20,9 @@ build_push() {
     docker push nfcore/vep:${VEP_TAG}.${GENOME}
 }
 
-build_push "GRCh37"    "homo_sapiens"           "104" "104.3"
+build_push "GRCh37"    "homo_sapiens"           "105" "105.0"
-build_push "GRCh38"    "homo_sapiens"           "104" "104.3"
+build_push "GRCh38"    "homo_sapiens"           "105" "105.0"
-build_push "GRCm38"    "mus_musculus"           "102" "104.3"
+build_push "GRCm38"    "mus_musculus"           "102" "105.0"
-build_push "GRCm39"    "mus_musculus"           "104" "104.3"
+build_push "GRCm39"    "mus_musculus"           "105" "105.0"
-build_push "CanFam3.1" "canis_lupus_familiaris" "104" "104.3"
+build_push "CanFam3.1" "canis_lupus_familiaris" "104" "105.0"
-build_push "WBcel235"  "caenorhabditis_elegans" "104" "104.3"
+build_push "WBcel235"  "caenorhabditis_elegans" "105" "105.0"

modules/ensemblvep/environment.yml

@@ -1,10 +1,10 @@
 # You can use this file to create a conda environment for this module:
 #   conda env create -f environment.yml
-name: nf-core-vep-104.3
+name: nf-core-vep-105.0
 channels:
   - conda-forge
   - bioconda
   - defaults
 
 dependencies:
-  - bioconda::ensembl-vep=104.3
+  - bioconda::ensembl-vep=105.0

modules/filtlong/main.nf

@@ -11,7 +11,7 @@ process FILTLONG {
     tuple val(meta), path(shortreads), path(longreads)
 
     output:
-    tuple val(meta), path("${meta.id}_lr_filtlong.fastq.gz"), emit: reads
+    tuple val(meta), path("*.fastq.gz"), emit: reads
     path "versions.yml"                                     , emit: versions
 
     when:
@@ -20,13 +20,14 @@ process FILTLONG {
     script:
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
-    def short_reads = meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
+    def short_reads = !shortreads ? "" : meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
+    if ("$longreads" == "${prefix}.fastq.gz") error "Longread FASTQ input and output names are the same, set prefix in module configuration to disambiguate!"
     """
     filtlong \\
         $short_reads \\
         $args \\
         $longreads \\
-        | gzip -n > ${prefix}_lr_filtlong.fastq.gz
+        | gzip -n > ${prefix}.fastq.gz
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

modules/gamma/gamma/main.nf

@@ -1,6 +1,6 @@
 def VERSION = '2.1' // Version information not provided by tool on CLI
 
-process GAMMA {
+process GAMMA_GAMMA {
     tag "$meta.id"
     label 'process_low'
 
@@ -26,13 +26,24 @@ process GAMMA {
     script:
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
+
     """
-    GAMMA.py \\
+    if [[ ${fasta} == *.gz ]]
+    then
+        FNAME=\$(basename ${fasta} .gz)
+        gunzip -f ${fasta}
+        GAMMA.py \\
+        $args \\
+        "\${FNAME}" \\
+        $db \\
+        $prefix
+    else
+        GAMMA.py \\
         $args \\
         $fasta \\
         $db \\
         $prefix
-
+    fi
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         gamma: $VERSION

modules/gamma/gamma/meta.yml

@@ -1,4 +1,4 @@
-name: "gamma"
+name: "gamma_gamma"
 description: Gene Allele Mutation Microbial Assessment
 keywords:
   - gamma
@@ -61,3 +61,4 @@ output:
 authors:
   - "@sateeshperi"
   - "@rastanton"
+  - "@jvhagey"

modules/gatk/unifiedgenotyper/main.nf

@@ -0,0 +1,63 @@
+process GATK_UNIFIEDGENOTYPER {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda (params.enable_conda ? "bioconda::gatk=3.5" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/gatk:3.5--hdfd78af_11':
+        'quay.io/biocontainers/gatk:3.5--hdfd78af_11' }"
+
+    input:
+    tuple val(meta), path(input), path(index)
+    path  fasta
+    path  fai
+    path  dict
+    path  intervals
+    path  contamination
+    path  dbsnp
+    path  comp
+
+    output:
+    tuple val(meta), path("*.vcf.gz"), emit: vcf
+    path "versions.yml"              , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def contamination_file = contamination ? "-contaminationFile ${contamination}" : ""
+    def dbsnp_file = dbsnp ? "--dbsnp ${dbsnp}" : ""
+    def comp_file = comp ? "--comp ${comp}" : ""
+    def intervals_file = intervals ? "--intervals ${intervals}" : ""
+
+    def avail_mem = 3
+    if (!task.memory) {
+        log.info '[GATK RealignerTargetCreator] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.'
+    } else {
+        avail_mem = task.memory.giga
+    }
+
+    """
+    gatk3 \\
+        -Xmx${avail_mem}g \\
+        -nt ${task.cpus} \\
+        -T UnifiedGenotyper \\
+        -I ${input} \\
+        -R ${fasta} \\
+        ${contamination_file} \\
+        ${dbsnp_file} \\
+        ${comp_file} \\
+        ${intervals_file} \\
+        -o ${prefix}.vcf \\
+        $args
+
+    gzip -n *.vcf
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        gatk: \$(echo \$(gatk3 --version))
+    END_VERSIONS
+    """
+}

modules/gatk/unifiedgenotyper/meta.yml

@@ -0,0 +1,73 @@
+name: "gatk_unifiedgenotyper"
+keywords:
+  - bam
+  - vcf
+  - variant calling
+tools:
+  - "gatk":
+      description: "The full Genome Analysis Toolkit (GATK) framework, license restricted."
+      homepage: "https://gatk.broadinstitute.org/hc/en-us"
+      documentation: "https://github.com/broadinstitute/gatk-docs"
+      licence: "['https://software.broadinstitute.org/gatk/download/licensing', 'BSD', 'https://www.broadinstitute.org/gatk/about/#licensing']"
+
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - input:
+      type: file
+      description: Sorted and indexed BAM/CRAM/SAM file
+      pattern: "*.bam"
+  - index:
+      type: file
+      description: BAM index file
+      pattern: "*.bai"
+  - fasta:
+      type: file
+      description: Reference file used to generate BAM file
+      pattern: ".{fasta,fa,fna}"
+  - fai:
+      type: file
+      description: Index of reference file used to generate BAM file
+      pattern: ".fai"
+  - dict:
+      type: file
+      description: GATK dict file for reference
+      pattern: ".dict"
+  - intervals:
+      type: file
+      description: Bed file with the genomic regions included in the library (optional)
+      pattern: "*.intervals"
+  - contamination:
+      type: file
+      description: Tab-separated file containing fraction of contamination in sequencing data (per sample) to aggressively remove
+      pattern: "*"
+  - dbsnps:
+      type: file
+      description: VCF file containing known sites (optional)
+      pattern: "*"
+  - comp:
+      type: file
+      description: Comparison VCF file (optional)
+      pattern: "*"
+
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - vcf:
+      type: file
+      description: VCF file containing called variants
+      pattern: "*.vcf.gz"
+
+authors:
+  - "@ilight1542"
+  - "@jfy133"

modules/gatk4/calibratedragstrmodel/main.nf

@@ -0,0 +1,51 @@
+process GATK4_CALIBRATEDRAGSTRMODEL {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda (params.enable_conda ? "bioconda::gatk4=4.2.6.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/gatk4:4.2.6.1--hdfd78af_0':
+        'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
+
+    input:
+    tuple val(meta), path(bam), path(bam_index), path(intervals)
+    path  fasta
+    path  fasta_fai
+    path  dict
+    path  strtablefile
+
+    output:
+    tuple val(meta), path("*.txt")   , emit: dragstr_model
+    path "versions.yml"              , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def intervals_command = intervals ? "--intervals $intervals" : ""
+
+    def avail_mem = 3
+    if (!task.memory) {
+        log.info '[GATK CalibrateDragstrModel] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.'
+    } else {
+        avail_mem = task.memory.giga
+    }
+    """
+    gatk --java-options "-Xmx${avail_mem}g" CalibrateDragstrModel \\
+        --input $bam \\
+        --output ${prefix}.txt \\
+        --reference $fasta \\
+        --str-table-path $strtablefile \\
+        --threads $task.cpus \\
+        $intervals_command \\
+        --tmp-dir . \\
+        $args
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
+    END_VERSIONS
+    """
+}

modules/gatk4/calibratedragstrmodel/meta.yml

@@ -0,0 +1,74 @@
+name: gatk4_calibratedragstrmodel
+description: estimates the parameters for the DRAGstr model
+keywords:
+  - gatk4
+  - bam
+  - cram
+  - sam
+  - calibratedragstrmodel
+tools:
+  - gatk4:
+      description:
+        Genome Analysis Toolkit (GATK4). Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools
+        with a primary focus on variant discovery and genotyping. Its powerful processing engine
+        and high-performance computing features make it capable of taking on projects of any size.
+      homepage: https://gatk.broadinstitute.org/hc/en-us
+      documentation: https://gatk.broadinstitute.org/hc/en-us/articles/360057441571-CalibrateDragstrModel-BETA-
+      tool_dev_url: https://github.com/broadinstitute/gatk
+      doi: 10.1158/1538-7445.AM2017-3590
+      licence: ["Apache-2.0"]
+
+input:
+  # Only when we have meta
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - bam:
+      type: file
+      description: BAM/CRAM/SAM file
+      pattern: "*.{bam,cram,sam}"
+  - bam_index:
+      type: file
+      description: index of the BAM/CRAM/SAM file
+      pattern: "*.{bai,crai,sai}"
+  - intervals:
+      type: file
+      description: BED file or interval list containing regions (optional)
+      pattern: "*.{bed,interval_list}"
+  - fasta:
+      type: file
+      description: The reference FASTA file
+      pattern: "*.{fasta,fa}"
+  - fasta_fai:
+      type: file
+      description: The index of the reference FASTA file
+      pattern: "*.fai"
+  - dict:
+      type: file
+      description: The sequence dictionary of the reference FASTA file
+      pattern: "*.dict"
+  - strtablefile:
+      type: file
+      description: The StrTableFile zip folder of the reference FASTA file
+      pattern: "*.zip"
+
+output:
+  #Only when we have meta
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - dragstr_model:
+      type: file
+      description: The DragSTR model
+      pattern: "*.txt"
+
+authors:
+  - "@nvnieuwk"

modules/gatk4/composestrtablefile/main.nf

@@ -0,0 +1,53 @@
+process GATK4_COMPOSESTRTABLEFILE {
+    tag "$fasta"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::gatk4=4.2.6.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/gatk4:4.2.6.1--hdfd78af_0':
+        'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
+
+    input:
+    path(fasta)
+    path(fasta_fai)
+    path(dict)
+
+    output:
+    path "*.zip"            , emit: str_table
+    path "versions.yml"     , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+
+    def avail_mem = 6
+    if (!task.memory) {
+        log.info '[GATK ComposeSTRTableFile] Available memory not known - defaulting to 6GB. Specify process memory requirements to change this.'
+    } else {
+        avail_mem = task.memory.giga
+    }
+    """
+    gatk --java-options "-Xmx${avail_mem}g" ComposeSTRTableFile \\
+        --reference $fasta \\
+        --output ${fasta.baseName}.zip \\
+        --tmp-dir . \\
+        $args
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
+    END_VERSIONS
+    """
+
+    stub:
+    """
+    touch test.zip
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
+    END_VERSIONS
+    """
+}

modules/gatk4/composestrtablefile/meta.yml

@@ -0,0 +1,43 @@
+name: "gatk4_composestrtablefile"
+description: This tool looks for low-complexity STR sequences along the reference that are later used to estimate the Dragstr model during single sample auto calibration CalibrateDragstrModel.
+keywords:
+  - gatk4
+  - composestrtablefile
+tools:
+  - gatk4:
+      description:
+        Genome Analysis Toolkit (GATK4). Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools
+        with a primary focus on variant discovery and genotyping. Its powerful processing engine
+        and high-performance computing features make it capable of taking on projects of any size.
+      homepage: https://gatk.broadinstitute.org/hc/en-us
+      documentation: https://gatk.broadinstitute.org/hc/en-us/articles/4405451249819-ComposeSTRTableFile
+      tool_dev_url: https://github.com/broadinstitute/gatk
+      doi: 10.1158/1538-7445.AM2017-3590
+      licence: ["Apache-2.0"]
+
+input:
+  - fasta:
+      type: file
+      description: FASTA reference file
+      pattern: "*.{fasta,fa}"
+  - fasta_fai:
+      type: file
+      description: index of the FASTA reference file
+      pattern: "*.fai"
+  - dict:
+      type: file
+      description: Sequence dictionary of the FASTA reference file
+      pattern: "*.dict"
+
+output:
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - str_table:
+      type: file
+      description: A zipped folder containing the STR table files
+      pattern: "*.zip"
+
+authors:
+  - "@nvnieuwk"

modules/gatk4/haplotypecaller/main.nf

@@ -8,7 +8,7 @@ process GATK4_HAPLOTYPECALLER {
         'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
 
     input:
-    tuple val(meta), path(input), path(input_index), path(intervals)
+    tuple val(meta), path(input), path(input_index), path(intervals), path(dragstr_model)
     path  fasta
     path  fai
     path  dict
@@ -28,6 +28,7 @@ process GATK4_HAPLOTYPECALLER {
     def prefix = task.ext.prefix ?: "${meta.id}"
     def dbsnp_command = dbsnp ? "--dbsnp $dbsnp" : ""
     def interval_command = intervals ? "--intervals $intervals" : ""
+    def dragstr_command = dragstr_model ? "--dragstr-params-path $dragstr_model" : ""
 
     def avail_mem = 3
     if (!task.memory) {
@@ -42,6 +43,7 @@ process GATK4_HAPLOTYPECALLER {
         --reference $fasta \\
         $dbsnp_command \\
         $interval_command \\
+        $dragstr_command \\
         --tmp-dir . \\
         $args
 

modules/gatk4/haplotypecaller/meta.yml

@@ -32,6 +32,10 @@ input:
   - intervals:
       type: file
       description: Bed file with the genomic regions included in the library (optional)
+  - dragstr_model:
+      type: file
+      description: Text file containing the DragSTR model of the used BAM/CRAM file (optional)
+      pattern: "*.txt"
   - fasta:
       type: file
       description: The reference fasta file

modules/gatk4/mergevcfs/main.nf

@@ -13,6 +13,7 @@ process GATK4_MERGEVCFS {
 
     output:
     tuple val(meta), path('*.vcf.gz'), emit: vcf
+    tuple val(meta), path("*.tbi")   , emit: tbi
     path  "versions.yml"             , emit: versions
 
     when:

modules/gatk4/mergevcfs/meta.yml

@@ -35,6 +35,11 @@ output:
       type: file
       description: merged vcf file
       pattern: "*.vcf.gz"
+  - tbi:
+      type: file
+      description: index files for the merged vcf files
+      pattern: "*.tbi"
+
   - versions:
       type: file
       description: File containing software versions

modules/kat/hist/main.nf

@@ -0,0 +1,42 @@
+process KAT_HIST {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda (params.enable_conda ? "bioconda::kat=2.4.2" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/kat:2.4.2--py38hfc5f9d8_2':
+        'quay.io/biocontainers/kat:2.4.2--py38hfc5f9d8_2' }"
+
+    input:
+    tuple val(meta), path(reads)
+
+    output:
+    tuple val(meta), path("*.hist")                   , emit: hist
+    tuple val(meta), path("*.hist.dist_analysis.json"), emit: json
+    tuple val(meta), path("*.png")                    , emit: png           , optional: true
+    tuple val(meta), path("*.ps")                     , emit: ps            , optional: true
+    tuple val(meta), path("*.pdf")                    , emit: pdf           , optional: true
+    tuple val(meta), path("*-hash.jf*")               , emit: jellyfish_hash, optional: true
+    path "versions.yml"                               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    kat hist \\
+        --threads $task.cpus \\
+        --output_prefix ${prefix}.hist \\
+        $args \\
+        $reads
+
+    ls -l
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        kat: \$( kat hist --version | sed 's/kat //' )
+    END_VERSIONS
+    """
+}

modules/kat/hist/meta.yml

@@ -0,0 +1,64 @@
+name: "kat_hist"
+description: Creates a histogram of the number of distinct k-mers having a given frequency.
+keywords:
+  - k-mer
+  - histogram
+  - count
+tools:
+  - "kat":
+      description: "KAT is a suite of tools that analyse jellyfish hashes or sequence files (fasta or fastq) using kmer counts"
+      homepage: https://www.earlham.ac.uk/kat-tools
+      documentation: https://kat.readthedocs.io/en/latest/index.html
+      tool_dev_url: https://github.com/TGAC/KAT
+      doi: http://bioinformatics.oxfordjournals.org/content/early/2016/10/20/bioinformatics.btw663.abstract
+      licence: "['GPL v3']"
+
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: file
+      description: |
+        List of input FastQ files of size 1 and 2 for single-end and paired-end data,
+        respectively.
+
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - hist:
+      type: file
+      description: KAT histogram of k-mer counts
+      pattern: "*.hist"
+  - json:
+      type: file
+      description: KAT histogram summary of distance analysis
+      pattern: "*.hist.dist_analysis.json"
+  - png:
+      type: file
+      description: KAT plot of k-mer histogram in PNG format
+      pattern: "*.png"
+  - ps:
+      type: file
+      description: KAT plot of k-mer histogram in PS format
+      pattern: "*.ps"
+  - pdf:
+      type: file
+      description: KAT plot of k-mer histogram in PDF format
+      pattern: "*.pdf"
+  - jellyfish_hash:
+      type: file
+      description: Jellyfish hash file
+      pattern: "*-hist.jf*"
+
+authors:
+  - "@mahesh-panchal"

modules/mash/screen/main.nf

@@ -8,8 +8,8 @@ process MASH_SCREEN {
         'quay.io/biocontainers/mash:2.3--he348c14_1' }"
 
     input:
-    tuple val(meta), path(query_sketch)
+    tuple val(meta), path(query)
-    path fastx_db
+    path sequences_sketch
 
     output:
     tuple val(meta), path("*.screen"), emit: screen
@@ -26,8 +26,8 @@ process MASH_SCREEN {
         screen \\
         $args \\
         -p $task.cpus \\
-        $query_sketch \\
+        $sequences_sketch \\
-        $fastx_db \\
+        $query \\
         > ${prefix}.screen
 
     cat <<-END_VERSIONS > versions.yml

modules/mash/screen/meta.yml

@@ -20,13 +20,14 @@ input:
       description: |
         Groovy Map containing sample information
         e.g. [ id:'test', single_end:false ]
-  - query_sketch:
+  - query:
       type: file
-      description: MinHash sketch of query sequences
+      description: Query sequences
-      pattern: "*.msh"
+      pattern: "*.fastq.gz"
-  - fastx_db:
+  - sequence_sketch:
       type: file
       description: Sequence files to match against
+      pattern: "*.msh"
 
 output:
   - meta:

modules/mosdepth/main.nf

@@ -13,15 +13,19 @@ process MOSDEPTH {
     path  fasta
 
     output:
-    tuple val(meta), path('*.global.dist.txt')    , emit: global_txt
+    tuple val(meta), path('*.global.dist.txt')      , emit: global_txt
-    tuple val(meta), path('*.region.dist.txt')    , emit: regions_txt , optional:true
+    tuple val(meta), path('*.summary.txt')          , emit: summary_txt
-    tuple val(meta), path('*.summary.txt')        , emit: summary_txt
+    tuple val(meta), path('*.region.dist.txt')      , optional:true, emit: regions_txt
-    tuple val(meta), path('*.per-base.d4')        , emit: per_base_d4 , optional:true
+    tuple val(meta), path('*.per-base.d4')          , optional:true, emit: per_base_d4
-    tuple val(meta), path('*.per-base.bed.gz')    , emit: per_base_bed, optional:true
+    tuple val(meta), path('*.per-base.bed.gz')      , optional:true, emit: per_base_bed
-    tuple val(meta), path('*.per-base.bed.gz.csi'), emit: per_base_csi, optional:true
+    tuple val(meta), path('*.per-base.bed.gz.csi')  , optional:true, emit: per_base_csi
-    tuple val(meta), path('*.regions.bed.gz')     , emit: regions_bed , optional:true
+    tuple val(meta), path('*.regions.bed.gz')       , optional:true, emit: regions_bed
-    tuple val(meta), path('*.regions.bed.gz.csi') , emit: regions_csi , optional:true
+    tuple val(meta), path('*.regions.bed.gz.csi')   , optional:true, emit: regions_csi
-    path  "versions.yml"                          , emit: versions
+    tuple val(meta), path('*.quantized.bed.gz')     , optional:true, emit: quantized_bed
+    tuple val(meta), path('*.quantized.bed.gz.csi') , optional:true, emit: quantized_csi
+    tuple val(meta), path('*.thresholds.bed.gz')    , optional:true, emit: thresholds_bed
+    tuple val(meta), path('*.thresholds.bed.gz.csi'), optional:true, emit: thresholds_csi
+    path  "versions.yml"                            , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -34,10 +38,13 @@ process MOSDEPTH {
     if (bed && args.contains("--by")) {
         exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
     }
+    if (!bed && args.contains("--thresholds")) {
+        exit 1, "'--thresholds' can only be specified in conjunction with '--by'"
+    }
 
     """
     mosdepth \\
-        --threads ${task.cpus} \\
+        --threads $task.cpus \\
         $interval \\
         $reference \\
         $args \\
@@ -61,6 +68,10 @@ process MOSDEPTH {
     touch ${prefix}.per-base.bed.gz.csi
     touch ${prefix}.regions.bed.gz
     touch ${prefix}.regions.bed.gz.csi
+    touch ${prefix}.quantized.bed.gz
+    touch ${prefix}.quantized.bed.gz.csi
+    touch ${prefix}.thresholds.bed.gz
+    touch ${prefix}.thresholds.bed.gz.csi
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

modules/mosdepth/meta.yml

@@ -72,6 +72,22 @@ output:
       type: file
       description: Index file for BED file with per-region coverage
       pattern: "*.{regions.bed.gz.csi}"
+  - quantized_bed:
+      type: file
+      description: BED file with binned coverage
+      pattern: "*.{quantized.bed.gz}"
+  - quantized_csi:
+      type: file
+      description: Index file for BED file with binned coverage
+      pattern: "*.{quantized.bed.gz.csi}"
+  - thresholds_bed:
+      type: file
+      description: BED file with the number of bases in each region that are covered at or above each threshold
+      pattern: "*.{thresholds.bed.gz}"
+  - thresholds_csi:
+      type: file
+      description: Index file for BED file with threshold coverage
+      pattern: "*.{thresholds.bed.gz.csi}"
   - versions:
       type: file
       description: File containing software versions

modules/picard/addorreplacereadgroups/main.nf

@@ -2,10 +2,10 @@ process PICARD_ADDORREPLACEREADGROUPS {
     tag "$meta.id"
     label 'process_low'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/cleansam/main.nf

@@ -2,10 +2,10 @@ process PICARD_CLEANSAM {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/collecthsmetrics/main.nf

@@ -2,10 +2,10 @@ process PICARD_COLLECTHSMETRICS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/collectmultiplemetrics/main.nf

@@ -2,10 +2,10 @@ process PICARD_COLLECTMULTIPLEMETRICS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/collectwgsmetrics/main.nf

@@ -2,10 +2,10 @@ process PICARD_COLLECTWGSMETRICS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/createsequencedictionary/main.nf

@@ -2,10 +2,10 @@ process PICARD_CREATESEQUENCEDICTIONARY {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(fasta)

modules/picard/crosscheckfingerprints/main.nf

@@ -2,10 +2,10 @@ process PICARD_CROSSCHECKFINGERPRINTS {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(input1)

modules/picard/filtersamreads/main.nf

@@ -2,10 +2,10 @@ process PICARD_FILTERSAMREADS {
     tag "$meta.id"
     label 'process_low'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam), path(readlist)

modules/picard/fixmateinformation/main.nf

@@ -2,10 +2,10 @@ process PICARD_FIXMATEINFORMATION {
     tag "$meta.id"
     label 'process_low'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/liftovervcf/main.nf

@@ -2,10 +2,10 @@ process PICARD_LIFTOVERVCF {
     tag "$meta.id"
     label 'process_low'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(input_vcf)

modules/picard/markduplicates/main.nf

@@ -2,10 +2,10 @@ process PICARD_MARKDUPLICATES {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/mergesamfiles/main.nf

@@ -2,10 +2,10 @@ process PICARD_MERGESAMFILES {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bams)

modules/picard/sortsam/main.nf

@@ -2,10 +2,10 @@ process PICARD_SORTSAM {
     tag "$meta.id"
     label 'process_low'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(bam)

modules/picard/sortvcf/main.nf

@@ -2,10 +2,10 @@ process PICARD_SORTVCF {
     tag "$meta.id"
     label 'process_medium'
 
-    conda (params.enable_conda ? "bioconda::picard=2.27.1" : null)
+    conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' :
+        'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
-        'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }"
+        'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(vcf)

modules/snippy/run/main.nf

@@ -0,0 +1,55 @@
+process SNIPPY_RUN {
+    tag "$meta.id"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::snippy=4.6.0" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/snippy:4.6.0--hdfd78af_2' :
+        'quay.io/biocontainers/snippy:4.6.0--hdfd78af_2' }"
+
+    input:
+    tuple val(meta), path(reads)
+    path reference
+
+    output:
+    tuple val(meta), path("${prefix}/${prefix}.tab")              , emit: tab
+    tuple val(meta), path("${prefix}/${prefix}.csv")              , emit: csv
+    tuple val(meta), path("${prefix}/${prefix}.html")             , emit: html
+    tuple val(meta), path("${prefix}/${prefix}.vcf")              , emit: vcf
+    tuple val(meta), path("${prefix}/${prefix}.bed")              , emit: bed
+    tuple val(meta), path("${prefix}/${prefix}.gff")              , emit: gff
+    tuple val(meta), path("${prefix}/${prefix}.bam")              , emit: bam
+    tuple val(meta), path("${prefix}/${prefix}.bam.bai")          , emit: bai
+    tuple val(meta), path("${prefix}/${prefix}.log")              , emit: log
+    tuple val(meta), path("${prefix}/${prefix}.aligned.fa")       , emit: aligned_fa
+    tuple val(meta), path("${prefix}/${prefix}.consensus.fa")     , emit: consensus_fa
+    tuple val(meta), path("${prefix}/${prefix}.consensus.subs.fa"), emit: consensus_subs_fa
+    tuple val(meta), path("${prefix}/${prefix}.raw.vcf")          , emit: raw_vcf
+    tuple val(meta), path("${prefix}/${prefix}.filt.vcf")         , emit: filt_vcf
+    tuple val(meta), path("${prefix}/${prefix}.vcf.gz")           , emit: vcf_gz
+    tuple val(meta), path("${prefix}/${prefix}.vcf.gz.csi")       , emit: vcf_csi
+    tuple val(meta), path("${prefix}/${prefix}.txt")              , emit: txt
+    path "versions.yml"                                           , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    prefix = task.ext.prefix ?: "${meta.id}"
+    def read_inputs = meta.single_end ? "--se ${reads[0]}" : "--R1 ${reads[0]} --R2 ${reads[1]}"
+    """
+    snippy \\
+        $args \\
+        --cpus $task.cpus \\
+        --outdir $prefix \\
+        --reference $reference \\
+        --prefix $prefix \\
+        $read_inputs
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        snippy: \$(echo \$(snippy --version 2>&1) | sed 's/snippy //')
+    END_VERSIONS
+    """
+}

modules/snippy/run/meta.yml

@@ -0,0 +1,110 @@
+name: snippy_run
+description: Rapid haploid variant calling
+keywords:
+  - variant
+  - fastq
+  - bacteria
+tools:
+  - snippy:
+      description: "Rapid bacterial SNP calling and core genome alignments"
+      homepage: "https://github.com/tseemann/snippy"
+      documentation: "https://github.com/tseemann/snippy"
+      tool_dev_url: "https://github.com/tseemann/snippy"
+      doi: ""
+      licence: "['GPL v2']"
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: file
+      description: |
+        List of input FastQ files of size 1 and 2 for single-end and paired-end data,
+        respectively.
+      pattern: "*.{fq,fastq,fq.gz,fastq.gz}"
+  - index:
+      type: file
+      description: Reference genome in GenBank (preferred) or FASTA format
+      pattern: "*.{gbk,gbk.gz,fa,fa.gz}"
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - tab:
+      type: file
+      description: A simple tab-separated summary of all the variants
+      pattern: "*.tab"
+  - csv:
+      type: file
+      description: A comma-separated version of the .tab file
+      pattern: "*.csv"
+  - html:
+      type: file
+      description: A HTML version of the .tab file
+      pattern: "*.html"
+  - vcf:
+      type: file
+      description: The final annotated variants in VCF format
+      pattern: "*.vcf"
+  - bed:
+      type: file
+      description: The variants in BED format
+      pattern: "*.bed"
+  - gff:
+      type: file
+      description: The variants in GFF3 format
+      pattern: "*.gff"
+  - bam:
+      type: file
+      description: The alignments in BAM format. Includes unmapped, multimapping reads. Excludes duplicates.
+      pattern: "*.bam"
+  - bai:
+      type: file
+      description: Index for the .bam file
+      pattern: "*.bam.bai"
+  - log:
+      type: file
+      description: A log file with the commands run and their outputs
+      pattern: "*.log"
+  - aligned_fa:
+      type: file
+      description: A version of the reference but with - at position with depth=0 and N for 0 < depth < --mincov (does not have variants)
+      pattern: "*.aligned.fa"
+  - consensus_fa:
+      type: file
+      description: A version of the reference genome with all variants instantiated
+      pattern: "*.consensus.fa"
+  - consensus_subs_fa:
+      type: file
+      description: A version of the reference genome with only substitution variants instantiated
+      pattern: "*.consensus.subs.fa"
+  - raw_vcf:
+      type: file
+      description: The unfiltered variant calls from Freebayes
+      pattern: "*.raw.vcf"
+  - filt_vcf:
+      type: file
+      description: The filtered variant calls from Freebayes
+      pattern: "*.filt.vcf"
+  - vcf_gz:
+      type: file
+      description: Compressed .vcf file via BGZIP
+      pattern: "*.vcf.gz"
+  - vcf_csi:
+      type: file
+      description: Index for the .vcf.gz via bcftools index
+      pattern: "*.vcf.gz.csi"
+  - txt:
+      type: file
+      description: Tab-separated columnar list of statistics
+      pattern: "*.txt"
+authors:
+  - "@rpetit3"

modules/star/align/main.nf

@@ -2,16 +2,15 @@ process STAR_ALIGN {
     tag "$meta.id"
     label 'process_high'
 
-    // Note: 2.7X indices incompatible with AWS iGenomes.
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
-    conda (params.enable_conda ? 'bioconda::star=2.7.9a' : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/star:2.7.9a--h9ee0642_0' :
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
-        'quay.io/biocontainers/star:2.7.9a--h9ee0642_0' }"
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
 
     input:
     tuple val(meta), path(reads)
-    path  index
+    path index
-    path  gtf
+    path gtf
     val star_ignore_sjdbgtf
     val seq_platform
     val seq_center
@@ -67,6 +66,8 @@ process STAR_ALIGN {
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         star: \$(STAR --version | sed -e "s/STAR_//g")
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+        gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
     END_VERSIONS
     """
 }

modules/star/genomegenerate/main.nf

@@ -2,19 +2,18 @@ process STAR_GENOMEGENERATE {
     tag "$fasta"
     label 'process_high'
 
-    // Note: 2.7X indices incompatible with AWS iGenomes.
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
-    conda (params.enable_conda ? "bioconda::star=2.7.9a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' :
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
-        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' }"
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
 
     input:
     path fasta
     path gtf
 
     output:
-    path "star"         , emit: index
+    path "star"        , emit: index
-    path "versions.yml" , emit: versions
+    path "versions.yml", emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -22,7 +21,7 @@ process STAR_GENOMEGENERATE {
     script:
     def args = task.ext.args ?: ''
     def args_list = args.tokenize()
-    def memory   = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
+    def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
     if (args_list.contains('--genomeSAindexNbases')) {
         """
         mkdir star

modules/untar/main.nf

@@ -21,12 +21,18 @@ process UNTAR {
     def args  = task.ext.args ?: ''
     def args2 = task.ext.args2 ?: ''
     untar     = archive.toString() - '.tar.gz'
+
     """
+    mkdir output
+
     tar \\
+        -C output --strip-components 1 \\
         -xzvf \\
         $args \\
         $archive \\
-        $args2 \\
+        $args2
+
+    mv output ${untar}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

modules/vsearch/usearchglobal/main.nf

@@ -0,0 +1,67 @@
+process VSEARCH_USEARCHGLOBAL {
+    tag "${meta.id}"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
+        'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
+
+    input:
+    tuple val(meta), path(queryfasta)
+    path db
+    val idcutoff
+    val outoption
+    val user_columns
+
+    output:
+    tuple val(meta), path('*.aln')    , optional: true, emit: aln
+    tuple val(meta), path('*.biom')   , optional: true, emit: biom
+    tuple val(meta), path('*.lca')    , optional: true, emit: lca
+    tuple val(meta), path('*.mothur') , optional: true, emit: mothur
+    tuple val(meta), path('*.otu')    , optional: true, emit: otu
+    tuple val(meta), path('*.sam')    , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')    , optional: true, emit: tsv
+    tuple val(meta), path('*.txt')    , optional: true, emit: txt
+    tuple val(meta), path('*.uc')     , optional: true, emit: uc
+    path "versions.yml"                               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def columns = user_columns ? "--userfields ${user_columns}" : ''
+    switch ( outoption ) {
+        case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
+        case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
+        case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
+        case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
+        case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+        case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+        case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
+        case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
+        default:
+            outfmt = "--alnout";
+            out_ext = 'aln';
+            log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
+            break
+    }
+    """
+    vsearch \\
+        --usearch_global $queryfasta \\
+        --db $db \\
+        --id $idcutoff \\
+        --threads $task.cpus \\
+        $args \\
+        ${columns} \\
+        ${outfmt} ${prefix}.${out_ext}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
+    END_VERSIONS
+    """
+}

modules/vsearch/usearchglobal/meta.yml

@@ -0,0 +1,83 @@
+name: "vsearch_usearchglobal"
+description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
+keywords:
+  - vsearch
+  - usearch
+  - alignment
+  - fasta
+tools:
+  - "vsearch":
+      description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
+      homepage: "https://github.com/torognes/vsearch"
+      documentation: "None"
+      tool_dev_url: "https://github.com/torognes/vsearch"
+      doi: "doi: 10.7717/peerj.2584"
+      licence: "['GPL v3-or-later OR BSD-2-clause']"
+
+input:
+  - meta:
+      type: map
+      description: Groovy Map containing sample information e.g. [ id:'test' ]
+  - queryfasta:
+      type: file
+      description: Query sequences in FASTA format
+      pattern: "*.{fasta,fa,fna,faa}"
+  - db:
+      type: file
+      description: Reference database file in FASTA or UDB format
+      pattern: "*"
+  - idcutoff:
+      type: real
+      description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
+  - outoption:
+      type: string
+      description: Specify the type of output file to be generated by selecting one of the vsearch output file options
+      pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
+  - user_columns:
+      type: string
+      description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
+
+output:
+  - aln:
+      type: file
+      description: Results in pairwise alignment format
+      pattern: "*.{aln}"
+  - biom:
+      type: file
+      description: Results in an OTU table in the biom version 1.0 file format
+      pattern: "*.{biom}"
+  - lca:
+      type: file
+      description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
+      pattern: "*.{lca}"
+  - mothur:
+      type: file
+      description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format
+      pattern: "*.{mothur}"
+  - otu:
+      type: file
+      description: Results in an OTU table in the classic tab-separated plain text format
+      pattern: "*.{otu}"
+  - sam:
+      type: file
+      description: Results written in sam format
+      pattern: "*.{sam}"
+  - tsv:
+      type: file
+      description: Results in tab-separated output, columns defined by user
+      pattern: "*.{tsv}"
+  - txt:
+      type: file
+      description: Tab delimited results in blast-like tabular format
+      pattern: "*.{txt}"
+  - uc:
+      type: file
+      description: Tab delimited results in a uclust-like format with 10 columns
+      pattern: "*.{uc}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+
+authors:
+  - "@jtangrot"

tests/config/pytest_modules.yml

@@ -711,9 +711,13 @@ freebayes:
   - modules/freebayes/**
   - tests/modules/freebayes/**
 
-gamma:
+gamma/gamma:
-  - modules/gamma/**
+  - modules/gamma/gamma/**
-  - tests/modules/gamma/**
+  - tests/modules/gamma/gamma/**
+
+gatk/unifiedgenotyper:
+  - modules/gatk/unifiedgenotyper/**
+  - tests/modules/gatk/unifiedgenotyper/**
 
 gatk4/applybqsr:
   - modules/gatk4/applybqsr/**
@@ -743,6 +747,10 @@ gatk4/calculatecontamination:
   - modules/gatk4/calculatecontamination/**
   - tests/modules/gatk4/calculatecontamination/**
 
+gatk4/calibratedragstrmodel:
+  - modules/gatk4/calibratedragstrmodel/**
+  - tests/modules/gatk4/calibratedragstrmodel/**
+
 gatk4/cnnscorevariants:
   - modules/gatk4/cnnscorevariants/**
   - tests/modules/gatk4/cnnscorevariants/**
@@ -751,6 +759,10 @@ gatk4/combinegvcfs:
   - modules/gatk4/combinegvcfs/**
   - tests/modules/gatk4/combinegvcfs/**
 
+gatk4/composestrtablefile:
+  - modules/gatk4/composestrtablefile/**
+  - tests/modules/gatk4/composestrtablefile/**
+
 gatk4/createsequencedictionary:
   - modules/gatk4/createsequencedictionary/**
   - tests/modules/gatk4/createsequencedictionary/**
@@ -1093,6 +1105,10 @@ kallistobustools/ref:
   - modules/kallistobustools/ref/**
   - tests/modules/kallistobustools/ref/**
 
+kat/hist:
+  - modules/kat/hist/**
+  - tests/modules/kat/hist/**
+
 khmer/normalizebymedian:
   - modules/khmer/normalizebymedian/**
   - tests/modules/khmer/normalizebymedian/**
@@ -1851,6 +1867,10 @@ snapaligner/index:
   - modules/snapaligner/index/**
   - tests/modules/snapaligner/index/**
 
+snippy/run:
+  - modules/snippy/run/**
+  - tests/modules/snippy/run/**
+
 snpdists:
   - modules/snpdists/**
   - tests/modules/snpdists/**
@@ -2052,6 +2072,10 @@ vcftools:
   - modules/vcftools/**
   - tests/modules/vcftools/**
 
+vsearch/usearchglobal:
+  - modules/vsearch/usearchglobal/**
+  - tests/modules/vsearch/usearchglobal/**
+
 yara/index:
   - modules/yara/index/**
   - tests/modules/yara/index/**

tests/config/test_data.config

@@ -23,6 +23,8 @@ params {
                 test_bed12                                     = "${test_data_dir}/genomics/sarscov2/genome/bed/test.bed12"
                 baits_bed                                      = "${test_data_dir}/genomics/sarscov2/genome/bed/baits.bed"
 
+                reference_cnn                                  = "${test_data_dir}/genomics/sarscov2/genome/cnn/reference.cnn"
+
                 kraken2                                        = "${test_data_dir}/genomics/sarscov2/genome/db/kraken2"
                 kraken2_tar_gz                                 = "${test_data_dir}/genomics/sarscov2/genome/db/kraken2.tar.gz"
 
@@ -121,6 +123,7 @@ params {
                 genome_elfasta                                 = "${test_data_dir}/genomics/homo_sapiens/genome/genome.elfasta"
                 genome_fasta                                   = "${test_data_dir}/genomics/homo_sapiens/genome/genome.fasta"
                 genome_fasta_fai                               = "${test_data_dir}/genomics/homo_sapiens/genome/genome.fasta.fai"
+                genome_strtablefile                            = "${test_data_dir}/genomics/homo_sapiens/genome/genome_strtablefile.zip"
                 genome_dict                                    = "${test_data_dir}/genomics/homo_sapiens/genome/genome.dict"
                 genome_gff3                                    = "${test_data_dir}/genomics/homo_sapiens/genome/genome.gff3"
                 genome_gtf                                     = "${test_data_dir}/genomics/homo_sapiens/genome/genome.gtf"
@@ -146,6 +149,7 @@ params {
                 genome_21_multi_interval_bed_gz                = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz"
                 genome_21_multi_interval_bed_gz_tbi            = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi"
                 genome_21_chromosomes_dir                      = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz"
+                genome_21_reference_cnn                        = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/reference_chr21.cnn"
 
                 dbsnp_146_hg38_elsites                         = "${test_data_dir}/genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.elsites"
                 dbsnp_146_hg38_vcf_gz                          = "${test_data_dir}/genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz"
@@ -262,6 +266,8 @@ params {
                 test_pileups_table                             = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test.pileups.table"
                 test2_pileups_table                            = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test2.pileups.table"
 
+                test_paired_end_sorted_dragstrmodel            = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_paired_end_sorted_dragstrmodel.txt"
+
                 test_genomicsdb_tar_gz                         = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_genomicsdb.tar.gz"
                 test_pon_genomicsdb_tar_gz                     = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_pon_genomicsdb.tar.gz"
 
@@ -323,6 +329,8 @@ params {
                 test_sv_vcf                                   =  "${test_data_dir}/genomics/homo_sapiens/illumina/vcf/sv_query.vcf.gz"
 
                 test_pytor                                    = "${test_data_dir}/genomics/homo_sapiens/illumina/pytor/test.pytor"
+
+                test_flowcell                                 = "${test_data_dir}/genomics/homo_sapiens/illumina/bcl/flowcell.tar.gz"
             }
             'pacbio' {
                 primers                         = "${test_data_dir}/genomics/homo_sapiens/pacbio/fasta/primers.fasta"
@@ -415,9 +423,6 @@ params {
             'txt' {
                 hello                           = "${test_data_dir}/generic/txt/hello.txt"
             }
-            'cnn' {
-                reference                       = "${test_data_dir}/generic/cnn/reference.cnn"
-            }
             'cooler'{
                 test_pairix_pair_gz             = "${test_data_dir}/genomics/homo_sapiens/cooler/cload/hg19/hg19.GM12878-MboI.pairs.subsample.blksrt.txt.gz"
                 test_pairix_pair_gz_px2         = "${test_data_dir}/genomics/homo_sapiens/cooler/cload/hg19/hg19.GM12878-MboI.pairs.subsample.blksrt.txt.gz.px2"

tests/modules/bcftools/concat/main.nf

@@ -4,13 +4,25 @@ nextflow.enable.dsl = 2
 
 include { BCFTOOLS_CONCAT } from '../../../../modules/bcftools/concat/main.nf'
 
-workflow test_bcftools_concat {
+workflow test_bcftools_concat_tbi {
     
     input = [ [ id:'test3' ], // meta map
               [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
-                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ]
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
+              [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true),
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz_tbi'], checkIfExists: true) ]
+            ]
+
+    BCFTOOLS_CONCAT ( input )
+}
+
+workflow test_bcftools_concat_no_tbi {
+    
+    input = [ [ id:'test3' ], // meta map
+              [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
+              []
             ]
 
-
     BCFTOOLS_CONCAT ( input )
 }

tests/modules/bcftools/concat/test.yml

@@ -1,8 +1,17 @@
-- name: bcftools concat test_bcftools_concat
+- name: bcftools concat test_bcftools_concat_tbi
-  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config
+  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_tbi -c ./tests/config/nextflow.config  -c ./tests/modules/bcftools/concat/nextflow.config
   tags:
-    - bcftools/concat
     - bcftools
+    - bcftools/concat
+  files:
+    - path: output/bcftools/test3.vcf.gz
+      md5sum: 35c88bfaad20101062e98beb217d7137
+
+- name: bcftools concat test_bcftools_concat_no_tbi
+  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_no_tbi -c ./tests/config/nextflow.config  -c ./tests/modules/bcftools/concat/nextflow.config
+  tags:
+    - bcftools
+    - bcftools/concat
   files:
     - path: output/bcftools/test3.vcf.gz
       md5sum: 35c88bfaad20101062e98beb217d7137

tests/modules/cnvkit/batch/main.nf

@@ -5,8 +5,9 @@ nextflow.enable.dsl = 2
 include { CNVKIT_BATCH as CNVKIT_HYBRID    } from '../../../../modules/cnvkit/batch/main.nf'
 include { CNVKIT_BATCH as CNVKIT_WGS       } from '../../../../modules/cnvkit/batch/main.nf'
 include { CNVKIT_BATCH as CNVKIT_TUMORONLY } from '../../../../modules/cnvkit/batch/main.nf'
+include { CNVKIT_BATCH as CNVKIT_GERMLINE } from '../../../../modules/cnvkit/batch/main.nf'
 
-workflow test_cnvkit_hybrid {
+workflow test_cnvkit_hybrid_somatic {
 
     input = [
         [ id:'test' ], // meta map
@@ -16,10 +17,10 @@ workflow test_cnvkit_hybrid {
     fasta   = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
     targets = file(params.test_data['sarscov2']['genome']['baits_bed'], checkIfExists: true)
 
-    CNVKIT_HYBRID ( input, fasta, targets, [] )
+    CNVKIT_HYBRID ( input, fasta, [], targets, [] )
 }
 
-workflow test_cnvkit_wgs {
+workflow test_cnvkit_wgs_somatic {
 
     input = [
         [ id:'test'], // meta map
@@ -28,42 +29,71 @@ workflow test_cnvkit_wgs {
     ]
     fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
 
-    CNVKIT_WGS ( input, fasta, [], [] )
+    CNVKIT_WGS ( input, fasta, [], [], [] )
 }
 
-workflow test_cnvkit_cram {
+workflow test_cnvkit_cram_wgs_somatic {
 
     input = [
         [ id:'test'], // meta map
         file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram'], checkIfExists: true),
         file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true)
     ]
-    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+    fasta     = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+    fasta_fai     = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
 
-    CNVKIT_WGS ( input, fasta, [], [] )
+    CNVKIT_WGS ( input, fasta, fasta_fai, [], [] )
 }
 
-workflow test_cnvkit_tumoronly {
+
+workflow test_cnvkit_tumoronly_hybrid_bam {
 
     input = [
         [ id:'test'], // meta map
-        file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_bam'], checkIfExists: true),
         []
     ]
-    reference = file(params.test_data['generic']['cnn']['reference'], checkIfExists: true)
+    reference = file(params.test_data['homo_sapiens']['genome']['genome_21_reference_cnn'], checkIfExists: true)
 
-    CNVKIT_TUMORONLY ( input, [], [], reference )
+    CNVKIT_TUMORONLY ( input, [], [],  [], reference )
 }
 
-workflow test_cnvkit_tumoronly_cram {
+workflow test_cnvkit_tumoronly_hybrid_cram {
 
     input = [
         [ id:'test'], // meta map
-        file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_cram'], checkIfExists: true),
         []
     ]
     fasta     = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
-    reference = file(params.test_data['generic']['cnn']['reference'], checkIfExists: true)
+    reference = file(params.test_data['homo_sapiens']['genome']['genome_21_reference_cnn'], checkIfExists: true)
 
-    CNVKIT_TUMORONLY ( input, fasta, [], reference )
+    CNVKIT_TUMORONLY ( input, fasta, [], [], reference )
+}
+
+workflow test_cnvkit_germline_hybrid_cram {
+
+    input = [
+        [ id:'test'], // meta map
+        [],
+        file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_cram'], checkIfExists: true)
+    ]
+    fasta     = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true)
+    fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta_fai'], checkIfExists: true)
+    targets   = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_bed'], checkIfExists: true)
+
+    CNVKIT_GERMLINE ( input, fasta, fasta_fai, targets,  [])
+}
+
+workflow test_cnvkit_germline_hybrid_bam {
+
+    input = [
+        [ id:'test'], // meta map
+        [],
+        file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_bam'], checkIfExists: true)
+    ]
+    fasta     = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true)
+    targets   = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_bed'], checkIfExists: true)
+
+    CNVKIT_GERMLINE ( input, fasta, [], targets,  [])
 }

tests/modules/cnvkit/batch/test.yml

@@ -1,5 +1,5 @@
-- name: cnvkit batch test_cnvkit_hybrid
+- name: cnvkit batch test_cnvkit_hybrid_somatic
-  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_hybrid -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
+  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_hybrid_somatic -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
   tags:
     - cnvkit
     - cnvkit/batch
@@ -26,8 +26,8 @@
     - path: output/cnvkit/test.single_end.sorted.targetcoverage.cnn
       md5sum: aa8a018b1d4d1e688c9f9f6ae01bf4d7
 
-- name: cnvkit batch test_cnvkit_wgs
+- name: cnvkit batch test_cnvkit_wgs_somatic
-  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_wgs -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
+  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_wgs_somatic -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
   tags:
     - cnvkit
     - cnvkit/batch
@@ -56,8 +56,8 @@
     - path: output/cnvkit/test2.paired_end.sorted.targetcoverage.cnn
       md5sum: 6ae6b3fce7299eedca6133d911c38fe1
 
-- name: cnvkit batch test_cnvkit_cram
+- name: cnvkit batch test_cnvkit_cram_wgs_somatic
-  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_cram -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
+  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_cram_wgs_somatic -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
   tags:
     - cnvkit
     - cnvkit/batch
@@ -86,22 +86,98 @@
     - path: output/cnvkit/test2.paired_end.sorted.targetcoverage.cnn
       md5sum: 6ae6b3fce7299eedca6133d911c38fe1
 
-- name: cnvkit batch test_cnvkit_tumoronly
+- name: cnvkit batch test_cnvkit_tumoronly_hybrid_bam
-  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
+  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly_hybrid_bam -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
   tags:
     - cnvkit
     - cnvkit/batch
   files:
-    - path: output/cnvkit/reference.antitarget-tmp.bed
+    - path: output/cnvkit/reference_chr21.antitarget-tmp.bed
-    - path: output/cnvkit/reference.target-tmp.bed
+      md5sum: 3d4d20f9f23b39970865d29ef239d20b
-      md5sum: 26d25ff2d6c45b6d92169b3559c6acdb
+    - path: output/cnvkit/reference_chr21.target-tmp.bed
+      md5sum: 657b25dbda8516624efa8cb2cf3716ca
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
+      md5sum: 067115082c4af4b64d58c0dc3a3642e4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
+      md5sum: f6adc75a0a86b7a921eca1b79a394cb0
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
+      md5sum: f7caeca04aba28b125ce26b511f42afb
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
+      md5sum: d9bdb71ce807051369577ee7f807a40c
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
+      md5sum: 2b56aac606ba6183d018b30ca58afcec
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
+      md5sum: e6d0190c1c37ce6e41f76ca5b24ccca3
 
-- name: cnvkit batch test_cnvkit_tumoronly_cram
+- name: cnvkit batch test_cnvkit_tumoronly_hybrid_cram
-  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly_cram -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
+  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly_hybrid_cram -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
   tags:
     - cnvkit
     - cnvkit/batch
   files:
-    - path: output/cnvkit/reference.antitarget-tmp.bed
+    - path: output/cnvkit/reference_chr21.antitarget-tmp.bed
-    - path: output/cnvkit/reference.target-tmp.bed
+      md5sum: 3d4d20f9f23b39970865d29ef239d20b
-      md5sum: 26d25ff2d6c45b6d92169b3559c6acdb
+    - path: output/cnvkit/reference_chr21.target-tmp.bed
+      md5sum: 657b25dbda8516624efa8cb2cf3716ca
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
+      md5sum: 067115082c4af4b64d58c0dc3a3642e4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
+      md5sum: f6adc75a0a86b7a921eca1b79a394cb0
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
+      md5sum: f7caeca04aba28b125ce26b511f42afb
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
+      md5sum: d9bdb71ce807051369577ee7f807a40c
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
+      md5sum: 2b56aac606ba6183d018b30ca58afcec
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
+      md5sum: e6d0190c1c37ce6e41f76ca5b24ccca3
+
+- name: cnvkit batch test_cnvkit_germline_hybrid_cram
+  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_germline_hybrid_cram -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
+  tags:
+    - cnvkit
+    - cnvkit/batch
+  files:
+    - path: output/cnvkit/multi_intervals.antitarget.bed
+      md5sum: 3d4d20f9f23b39970865d29ef239d20b
+    - path: output/cnvkit/multi_intervals.target.bed
+      md5sum: 86d30493bb2e619a93f4ebc2923d29f3
+    - path: output/cnvkit/reference.cnn
+      md5sum: a09ee4be5dda1cf0f68073bdb3aad8ec
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
+      md5sum: 067115082c4af4b64d58c0dc3a3642e4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
+      md5sum: 68b62b75cd91b2ffe5633686fb943490
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
+      md5sum: df196edd72613c59186f4d87df3dc4a4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
+      md5sum: 3b4fc0cc73be78f978cfe2422470753e
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
+      md5sum: 4e67451dbcb6601fc3fa5dd7e570f1d4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
+      md5sum: b4a49faf170e436ec32dcc21ccc3ce8f
+
+- name: cnvkit batch test_cnvkit_germline_hybrid_bam
+  command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_germline_hybrid_bam -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/batch/nextflow.config
+  tags:
+    - cnvkit
+    - cnvkit/batch
+  files:
+    - path: output/cnvkit/multi_intervals.antitarget.bed
+      md5sum: 3d4d20f9f23b39970865d29ef239d20b
+    - path: output/cnvkit/multi_intervals.target.bed
+      md5sum: 86d30493bb2e619a93f4ebc2923d29f3
+    - path: output/cnvkit/reference.cnn
+      md5sum: a09ee4be5dda1cf0f68073bdb3aad8ec
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
+      md5sum: 067115082c4af4b64d58c0dc3a3642e4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
+      md5sum: 68b62b75cd91b2ffe5633686fb943490
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
+      md5sum: df196edd72613c59186f4d87df3dc4a4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
+      md5sum: 3b4fc0cc73be78f978cfe2422470753e
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
+      md5sum: 4e67451dbcb6601fc3fa5dd7e570f1d4
+    - path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
+      md5sum: b4a49faf170e436ec32dcc21ccc3ce8f

tests/modules/deeptools/bamcoverage/main.nf

@@ -12,7 +12,7 @@ workflow test_deeptools_bamcoverage_bam {
           file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
         ]
 
-    DEEPTOOLS_BAMCOVERAGE ( input )
+    DEEPTOOLS_BAMCOVERAGE ( input, [], [] )
 }
 
 workflow test_deeptools_bamcoverage_cram {
@@ -22,6 +22,20 @@ workflow test_deeptools_bamcoverage_cram {
           file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
           file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
         ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+    fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
 
-    DEEPTOOLS_BAMCOVERAGE ( input )
+    DEEPTOOLS_BAMCOVERAGE ( input, fasta, fasta_fai)
+}
+
+workflow test_deeptools_bamcoverage_cram_no_fasta_fai {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+          file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+          file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
+        ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    DEEPTOOLS_BAMCOVERAGE ( input, fasta, [])
 }

tests/modules/deeptools/bamcoverage/test.yml

@@ -1,21 +1,26 @@
 - name: deeptools bamcoverage test_deeptools_bamcoverage_bam
-  command: nextflow run tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_bam -c tests/config/nextflow.config
+  command: nextflow run ./tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_bam -c ./tests/config/nextflow.config  -c ./tests/modules/deeptools/bamcoverage/nextflow.config
   tags:
-    - deeptools
     - deeptools/bamcoverage
+    - deeptools
   files:
     - path: output/deeptools/test.bigWig
       md5sum: 95fe9383a9e6c02aea6b785cf074274f
-    - path: output/deeptools/versions.yml
-      md5sum: 68c94e73b7a8c0935578bad61fea54c1
 
 - name: deeptools bamcoverage test_deeptools_bamcoverage_cram
-  command: nextflow run tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_cram -c tests/config/nextflow.config
+  command: nextflow run ./tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_cram -c ./tests/config/nextflow.config  -c ./tests/modules/deeptools/bamcoverage/nextflow.config
   tags:
-    - deeptools
     - deeptools/bamcoverage
+    - deeptools
+  files:
+    - path: output/deeptools/test.bigWig
+      md5sum: 95fe9383a9e6c02aea6b785cf074274f
+
+- name: deeptools bamcoverage test_deeptools_bamcoverage_cram_no_fasta_fai
+  command: nextflow run ./tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_cram_no_fasta_fai -c ./tests/config/nextflow.config  -c ./tests/modules/deeptools/bamcoverage/nextflow.config
+  tags:
+    - deeptools/bamcoverage
+    - deeptools
   files:
     - path: output/deeptools/test.bigWig
       md5sum: 95fe9383a9e6c02aea6b785cf074274f
-    - path: output/deeptools/versions.yml
-      md5sum: 665bbd2979c49bf3974a24bd44a88e94

tests/modules/filtlong/nextflow.config

@@ -2,4 +2,7 @@ process {
 
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
 
+    ext.args = "--min_length 10"
+    ext.prefix = "test_lr"
+
 }

tests/modules/filtlong/test.yml

@@ -1,23 +1,26 @@
 - name: filtlong test_filtlong
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
   tags:
     - filtlong
   files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
+    - path: output/filtlong/test_lr.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
 
 - name: filtlong test_filtlong_illumina_se
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
   tags:
     - filtlong
   files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
+    - path: output/filtlong/test_lr.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
 
 - name: filtlong test_filtlong_illumina_pe
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
   tags:
     - filtlong
   files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
+    - path: output/filtlong/test_lr.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"

tests/modules/gamma/gamma/main.nf

@@ -0,0 +1,29 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GAMMA_GAMMA } from '../../../../modules/gamma/gamma/main.nf'
+
+workflow test_unzip {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['bacteroides_fragilis']['illumina']['test1_contigs_fa_gz'], checkIfExists: true),
+    ]
+
+    db = [ file("https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/delete_me/srst2/ResGANNCBI_20210507_srst2.fasta", checkIfExists: true), ]
+
+    GAMMA_GAMMA ( input, db )
+}
+
+workflow test_gamma {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    ]
+
+    db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
+
+    GAMMA_GAMMA ( input, db )
+}

tests/modules/gamma/gamma/test.yml

@@ -0,0 +1,29 @@
+- name: gamma gamma test_unzip
+  command: nextflow run tests/modules/gamma/gamma -entry test_unzip -c tests/config/nextflow.config
+  tags:
+    - gamma/gamma
+    - gamma
+  files:
+    - path: output/gamma/test.fasta
+      md5sum: 5b3b831d863fffaa3410a9ee7bfa12ce
+    - path: output/gamma/test.gamma
+      md5sum: 46165a89e10b7315d3a9b0aa6c561626
+    - path: output/gamma/test.psl
+      md5sum: f489ce4602ddbcb692d5781ee3fbf449
+    - path: output/gamma/versions.yml
+      md5sum: 8baafec7b3b87f788f69e30d317c9722
+
+- name: gamma gamma test_gamma
+  command: nextflow run tests/modules/gamma/gamma -entry test_gamma -c tests/config/nextflow.config
+  tags:
+    - gamma/gamma
+    - gamma
+  files:
+    - path: output/gamma/test.fasta
+      md5sum: df37b48466181311e0a679f3c5878484
+    - path: output/gamma/test.gamma
+      md5sum: 3256708fa517a65ed01d99e0e3c762ae
+    - path: output/gamma/test.psl
+      md5sum: 162a2757ed3b167ae1e0cdb24213f940
+    - path: output/gamma/versions.yml
+      md5sum: b75c2871d8cac2f8ac67c0fbd22babd6

tests/modules/gamma/main.nf

@@ -1,17 +0,0 @@
-#!/usr/bin/env nextflow
-
-nextflow.enable.dsl = 2
-
-include { GAMMA } from '../../../modules/gamma/main.nf'
-
-workflow test_gamma {
-    
-    input = [
-        [ id:'test', single_end:false ], // meta map
-        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-    ]
-
-    db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
-
-    GAMMA ( input, db )
-}

tests/modules/gamma/test.yml

@@ -1,13 +0,0 @@
-- name: gamma test_gamma
-  command: nextflow run tests/modules/gamma -entry test_gamma -c tests/config/nextflow.config
-  tags:
-    - gamma
-  files:
-    - path: output/gamma/test.fasta
-      md5sum: df37b48466181311e0a679f3c5878484
-    - path: output/gamma/test.gamma
-      md5sum: 3256708fa517a65ed01d99e0e3c762ae
-    - path: output/gamma/test.psl
-      md5sum: 162a2757ed3b167ae1e0cdb24213f940
-    - path: output/gamma/versions.yml
-      md5sum: 3fefb5b46c94993362243c5f9a472057

tests/modules/gatk/unifiedgenotyper/main.nf

@@ -0,0 +1,18 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GATK_UNIFIEDGENOTYPER } from '../../../../modules/gatk/unifiedgenotyper/main.nf'
+
+workflow test_gatk_unifiedgenotyper {
+
+    input     = [ [ id:'test' ], // meta map
+                  file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+                  file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                ]
+    fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    fai = file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true)
+    dict = file(params.test_data['sarscov2']['genome']['genome_dict'], checkIfExists: true)
+
+    GATK_UNIFIEDGENOTYPER ( input, fasta, fai, dict, [], [], [], [])
+}

tests/modules/gatk/unifiedgenotyper/nextflow.config

@@ -0,0 +1,5 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}

tests/modules/gatk/unifiedgenotyper/test.yml

@@ -0,0 +1,9 @@
+- name: gatk unifiedgenotyper test_gatk_unifiedgenotyper
+  command: nextflow run ./tests/modules/gatk/unifiedgenotyper -entry test_gatk_unifiedgenotyper -c ./tests/config/nextflow.config  -c ./tests/modules/gatk/unifiedgenotyper/nextflow.config
+  tags:
+    - gatk
+    - gatk/unifiedgenotyper
+  files:
+    - path: output/gatk/test.vcf.gz
+      contains:
+        - "#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	test"

tests/modules/gatk4/calibratedragstrmodel/main.nf

@@ -0,0 +1,66 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GATK4_CALIBRATEDRAGSTRMODEL } from '../../../../modules/gatk4/calibratedragstrmodel/main.nf'
+
+workflow test_gatk4_calibratedragstrmodel_bam {
+    
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+        []
+    ]
+
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+
+    dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
+
+    strtablefile = file(params.test_data['homo_sapiens']['genome']['genome_strtablefile'], checkIfExists: true)
+
+    GATK4_CALIBRATEDRAGSTRMODEL ( input, fasta, fasta_fai, dict, strtablefile )
+}
+
+workflow test_gatk4_calibratedragstrmodel_cram {
+    
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
+        []
+    ]
+
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+
+    dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
+
+    strtablefile = file(params.test_data['homo_sapiens']['genome']['genome_strtablefile'], checkIfExists: true)
+
+    GATK4_CALIBRATEDRAGSTRMODEL ( input, fasta, fasta_fai, dict, strtablefile )
+}
+
+workflow test_gatk4_calibratedragstrmodel_beds {
+    
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+    ]
+
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+
+    dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
+
+    strtablefile = file(params.test_data['homo_sapiens']['genome']['genome_strtablefile'], checkIfExists: true)
+
+    GATK4_CALIBRATEDRAGSTRMODEL ( input, fasta, fasta_fai, dict, strtablefile )
+}
+

tests/modules/gatk4/calibratedragstrmodel/nextflow.config

@@ -0,0 +1,5 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}

tests/modules/gatk4/calibratedragstrmodel/test.yml

@@ -0,0 +1,26 @@
+- name: gatk4 calibratedragstrmodel test_gatk4_calibratedragstrmodel_bam
+  command: nextflow run ./tests/modules/gatk4/calibratedragstrmodel -entry test_gatk4_calibratedragstrmodel_bam -c ./tests/config/nextflow.config  -c ./tests/modules/gatk4/calibratedragstrmodel/nextflow.config
+  tags:
+    - gatk4
+    - gatk4/calibratedragstrmodel
+  files:
+    - path: output/gatk4/test.txt
+      md5sum: e16fa32906c74bb18b93e98a86718ff1
+
+- name: gatk4 calibratedragstrmodel test_gatk4_calibratedragstrmodel_cram
+  command: nextflow run ./tests/modules/gatk4/calibratedragstrmodel -entry test_gatk4_calibratedragstrmodel_cram -c ./tests/config/nextflow.config  -c ./tests/modules/gatk4/calibratedragstrmodel/nextflow.config
+  tags:
+    - gatk4
+    - gatk4/calibratedragstrmodel
+  files:
+    - path: output/gatk4/test.txt
+      md5sum: 81c7bf338886cb4d5c2cc07fc56afe44
+
+- name: gatk4 calibratedragstrmodel test_gatk4_calibratedragstrmodel_beds
+  command: nextflow run ./tests/modules/gatk4/calibratedragstrmodel -entry test_gatk4_calibratedragstrmodel_beds -c ./tests/config/nextflow.config  -c ./tests/modules/gatk4/calibratedragstrmodel/nextflow.config
+  tags:
+    - gatk4
+    - gatk4/calibratedragstrmodel
+  files:
+    - path: output/gatk4/test.txt
+      md5sum: cb6a9acdee042302b54fd1f59b5f54ee

tests/modules/gatk4/composestrtablefile/main.nf

@@ -0,0 +1,16 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GATK4_COMPOSESTRTABLEFILE } from '../../../../modules/gatk4/composestrtablefile/main.nf'
+
+workflow test_gatk4_composestrtablefile {
+    
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+
+    dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
+
+    GATK4_COMPOSESTRTABLEFILE ( fasta, fasta_fai, dict )
+}

tests/modules/gatk4/composestrtablefile/nextflow.config

@@ -0,0 +1,5 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}

tests/modules/gatk4/composestrtablefile/test.yml

@@ -0,0 +1,7 @@
+- name: gatk4 composestrtablefile test_gatk4_composestrtablefile
+  command: nextflow run ./tests/modules/gatk4/composestrtablefile -entry test_gatk4_composestrtablefile -c ./tests/config/nextflow.config  -c ./tests/modules/gatk4/composestrtablefile/nextflow.config
+  tags:
+    - gatk4/composestrtablefile
+    - gatk4
+  files:
+    - path: output/gatk4/genome.zip

tests/modules/gatk4/haplotypecaller/main.nf

@@ -8,6 +8,7 @@ workflow test_gatk4_haplotypecaller {
     input     = [ [ id:'test' ], // meta map
                   file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
                   file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
+                  [],
                   []
                 ]
     fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
@@ -21,6 +22,7 @@ workflow test_gatk4_haplotypecaller_cram {
     input = [ [ id:'test' ], // meta map
                 file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
                 file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
+                [],
                 []
               ]
     fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
@@ -34,7 +36,8 @@ workflow test_gatk4_haplotypecaller_intervals_dbsnp {
    input = [ [ id:'test' ], // meta map
                 file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
                 file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
-                file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+                file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true),
+                []
             ]
 
     fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
@@ -45,3 +48,20 @@ workflow test_gatk4_haplotypecaller_intervals_dbsnp {
 
     GATK4_HAPLOTYPECALLER ( input, fasta, fai, dict, sites, sites_tbi )
 }
+
+workflow test_gatk4_haplotypecaller_dragstr_model {
+   input = [ [ id:'test' ], // meta map
+                file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+                file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
+                [],
+                file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_dragstrmodel'], checkIfExists: true)
+            ]
+
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+    fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+    dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
+    sites = []
+    sites_tbi = []
+
+    GATK4_HAPLOTYPECALLER ( input, fasta, fai, dict, sites, sites_tbi )
+}

tests/modules/gatk4/haplotypecaller/test.yml

@@ -6,7 +6,6 @@
   files:
     - path: output/gatk4/test.vcf.gz
     - path: output/gatk4/test.vcf.gz.tbi
-    - path: output/gatk4/versions.yml
 
 - name: gatk4 haplotypecaller test_gatk4_haplotypecaller_cram
   command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_cram -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config
@@ -16,7 +15,6 @@
   files:
     - path: output/gatk4/test.vcf.gz
     - path: output/gatk4/test.vcf.gz.tbi
-    - path: output/gatk4/versions.yml
 
 - name: gatk4 haplotypecaller test_gatk4_haplotypecaller_intervals_dbsnp
   command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_intervals_dbsnp -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config
@@ -26,4 +24,12 @@
   files:
     - path: output/gatk4/test.vcf.gz
     - path: output/gatk4/test.vcf.gz.tbi
-    - path: output/gatk4/versions.yml
+
+- name: gatk4 haplotypecaller test_gatk4_haplotypecaller_dragstr_model
+  command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_dragstr_model -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config
+  tags:
+    - gatk4/haplotypecaller
+    - gatk4
+  files:
+    - path: output/gatk4/test.vcf.gz
+    - path: output/gatk4/test.vcf.gz.tbi

tests/modules/gatk4/mergevcfs/test.yml

@@ -6,6 +6,8 @@
   files:
     - path: output/gatk4/test.vcf.gz
       md5sum: 5b289bda88d3a3504f2e19ee8cff177c
+    - path: output/gatk4/test.vcf.gz.tbi
+      md5sum: a81673763b13086cfce9a23e72a35a16
     - path: output/gatk4/versions.yml
 
 - name: gatk4 mergevcfs test_gatk4_mergevcfs_no_dict

tests/modules/kat/hist/main.nf

@@ -0,0 +1,28 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { KAT_HIST } from '../../../../modules/kat/hist/main.nf'
+
+workflow test_kat_hist_single_end {
+
+    input = [
+        [ id:'test', single_end:true ], // meta map
+        file(params.test_data['homo_sapiens']['illumina']['test2_1_fastq_gz'], checkIfExists: true)
+    ]
+
+    KAT_HIST ( input )
+}
+
+workflow test_kat_hist_paired_end {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        [
+            file(params.test_data['homo_sapiens']['illumina']['test2_1_fastq_gz'], checkIfExists: true),
+            file(params.test_data['homo_sapiens']['illumina']['test2_2_fastq_gz'], checkIfExists: true),
+        ]
+    ]
+
+    KAT_HIST ( input )
+}

tests/modules/kat/hist/nextflow.config

@@ -0,0 +1,9 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+
+    withName: 'test_kat_hist_single_end:KAT_HIST' {
+        ext.args = '-d'
+    }
+
+}

tests/modules/kat/hist/test.yml

@@ -0,0 +1,42 @@
+- name: kat hist test_kat_hist_single_end
+  command: nextflow run tests/modules/kat/hist -entry test_kat_hist_single_end -c tests/config/nextflow.config
+  tags:
+    - kat/hist
+    - kat
+  files:
+    - path: output/kat/test.hist
+      md5sum: c6eba52b3a2653a684577a8ae20b74c1
+    - path: output/kat/test.hist-hash.jf27
+    - path: output/kat/test.hist.dist_analysis.json
+      # md5sum: 52a5a2d91c71b940f36f1f0a7fd5ef10 # This is variable for an unknown reason
+      contains:
+        - "nb_peaks"
+        - "global_minima"
+        - "global_maxima"
+        - "mean_freq"
+        - "est_genome_size"
+        - "est_het_rate"
+    - path: output/kat/test.hist.png
+      md5sum: 49861ef1a265e0edde3550b39c64a274
+    - path: output/kat/versions.yml
+
+- name: kat hist test_kat_hist_paired_end
+  command: nextflow run tests/modules/kat/hist -entry test_kat_hist_paired_end -c tests/config/nextflow.config
+  tags:
+    - kat/hist
+    - kat
+  files:
+    - path: output/kat/test.hist
+      md5sum: 91429091e74b1718051591d83a1ccb5d
+    - path: output/kat/test.hist.dist_analysis.json
+      # md5sum: 8b0dabeaff4ba706b33aa8964d687e13  # This is variable for an unknown reason
+      contains:
+        - "nb_peaks"
+        - "global_minima"
+        - "global_maxima"
+        - "mean_freq"
+        - "est_genome_size"
+        - "est_het_rate"
+    - path: output/kat/test.hist.png
+      md5sum: e20774d0d2b979cb6ead7b7fb5ad36d9
+    - path: output/kat/versions.yml

tests/modules/mash/screen/main.nf

@@ -14,8 +14,11 @@ workflow test_mash_screen {
             file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
         ]
     ]
-    fastx_db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    sars_db = [
+        [ id: 'sars_db' ],
+        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    ]
 
-    MASH_SKETCH ( input )
+    MASH_SKETCH ( sars_db )
-    MASH_SCREEN ( MASH_SKETCH.out.mash, fastx_db )
+    MASH_SCREEN ( input, MASH_SKETCH.out.mash.map { meta, sketch -> sketch } )
 }

tests/modules/mash/screen/test.yml

@@ -4,9 +4,9 @@
     - mash
     - mash/screen
   files:
-    - path: output/mash/test.mash_stats
+    - path: output/mash/sars_db.mash_stats
-      md5sum: 2a6f297d8e69a5e4160243bc6c89129c
+      md5sum: 1dafbd23e36e18bf4c87a007d0fc98f7
-    - path: output/mash/test.msh
+    - path: output/mash/sars_db.msh
-      md5sum: d747145a43dad5f82342036f8f5d9133
+      md5sum: 24289e4a13526e88eeb2abfca4a0f0a8
     - path: output/mash/test.screen
-      md5sum: d3c871dccd5cd57ab54781fa5c5d7278
+      md5sum: ac8701e1aab651b2f36c6380b1351b11

tests/modules/mosdepth/main.nf

@@ -2,72 +2,95 @@
 
 nextflow.enable.dsl = 2
 
-include { MOSDEPTH                    } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH                       } from '../../../modules/mosdepth/main.nf'
-include { MOSDEPTH as MOSDEPTH_FAIL   } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_FAIL      } from '../../../modules/mosdepth/main.nf'
-include { MOSDEPTH as MOSDEPTH_WINDOW } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_WINDOW    } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_THRESHOLD } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_QUANTIZED } from '../../../modules/mosdepth/main.nf'
 
 workflow test_mosdepth {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
 
     MOSDEPTH ( input, [], [] )
 }
 
 workflow test_mosdepth_bed {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH ( input, bed, [] )
 }
 
 workflow test_mosdepth_cram {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
-            ]
+    ]
-    fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
 
     MOSDEPTH ( input, [], fasta )
 }
 
 workflow test_mosdepth_cram_bed {
     input  = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
-    fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
 
     MOSDEPTH ( input, bed, fasta )
 }
 
 workflow test_mosdepth_window {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH_WINDOW ( input, [], [] )
 }
 
+workflow test_mosdepth_quantized {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+
+    MOSDEPTH_QUANTIZED ( input, [], [] )
+}
+
+workflow test_mosdepth_thresholds {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+
+    MOSDEPTH_THRESHOLD ( input, bed, [] )
+}
+
 workflow test_mosdepth_fail {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH_FAIL ( input, bed, [] )
 }

tests/modules/mosdepth/nextflow.config

@@ -7,4 +7,10 @@ process {
     withName: MOSDEPTH_WINDOW {
         ext.args = "--by 100"
     }
+    withName: MOSDEPTH_QUANTIZED {
+        ext.args = "--quantize 0:1:4:100:200"
+    }
+    withName: MOSDEPTH_THRESHOLD {
+        ext.args = "--thresholds 1,10,20,30"
+    }
 }

tests/modules/mosdepth/test.yml

@@ -86,6 +86,48 @@
     - path: output/mosdepth/test.regions.bed.gz.csi
       md5sum: 257d67678136963d9dd904330079609d
 
+- name: mosdepth test_mosdepth_quantized
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_quantized -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 4f0d231060cbde4efdd673863bd2fb59
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.quantized.bed.gz
+      md5sum: 3e434a8bafcf59a67841ae3d4d752838
+    - path: output/mosdepth/test.quantized.bed.gz.csi
+      md5sum: be9617f551f19a33923f1e886eaefb93
+
+- name: mosdepth test_mosdepth_thresholds
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_thresholds -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.region.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 96c037f769974b904beb53edc4f56d82
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.regions.bed.gz
+      md5sum: 5d398caf7171ec4406278e2add3009ae
+    - path: output/mosdepth/test.regions.bed.gz.csi
+      md5sum: 47669cfe41f3e222e74d81e1b1be191f
+    - path: output/mosdepth/test.thresholds.bed.gz
+      md5sum: 13101e326eea3cbfa1d569b69f494f4c
+    - path: output/mosdepth/test.thresholds.bed.gz.csi
+      md5sum: 912055ee9452229439df6fae95644196
+
 - name: mosdepth test_mosdepth_fail
   command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_fail -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
   tags:

tests/modules/snippy/run/main.nf

@@ -0,0 +1,16 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { SNIPPY_RUN } from '../../../../modules/snippy/run/main.nf'
+
+workflow test_snippy_run {
+    
+    input = [ [ id:'test', single_end:false ], // meta map
+              [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
+            ]
+    reference = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+
+    SNIPPY_RUN ( input, reference )
+}

tests/modules/snippy/run/nextflow.config

@@ -0,0 +1,5 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}

tests/modules/snippy/run/test.yml

@@ -0,0 +1,39 @@
+- name: snippy run test_snippy_run
+  command: |
+    nextflow run tests/modules/snippy/run -entry test_snippy_run -c tests/config/nextflow.config -c tests/modules/snippy/run/nextflow.config
+  tags:
+    - snippy/run
+    - snippy
+  files:
+    - path: output/snippy/test/test.aligned.fa
+      md5sum: 47e3390d4167edf1955d162d37aca5e3
+    - path: output/snippy/test/test.bam
+    - path: output/snippy/test/test.bam.bai
+    - path: output/snippy/test/test.bed
+    - path: output/snippy/test/test.consensus.fa
+      md5sum: 483f4a5dfe60171c86ee9b7e6dff908b
+    - path: output/snippy/test/test.consensus.subs.fa
+      md5sum: 483f4a5dfe60171c86ee9b7e6dff908b
+    - path: output/snippy/test/test.csv
+      md5sum: 322f942115e5945c2041a88246166703
+    - path: output/snippy/test/test.filt.vcf
+      contains: ["fileformat", "freebayes", "CHROM"]
+    - path: output/snippy/test/test.gff
+      md5sum: df19e1b84ba6f691d20c72b397c88abf
+    - path: output/snippy/test/test.html
+      md5sum: 1ccbf0ffcadae1a6b2e11681d24c9938
+    - path: output/snippy/test/test.log
+      contains: ["snippy", "consensus", "subs"]
+    - path: output/snippy/test/test.raw.vcf
+      contains: ["fileformat", "freebayes", "CHROM"]
+    - path: output/snippy/test/test.tab
+      md5sum: beb9bde3bce985e53e8feba9ec5b136e
+    - path: output/snippy/test/test.txt
+      contains: ["DateTime", "ReadFiles", "VariantTotal"]
+    - path: output/snippy/test/test.vcf
+      contains: ["fileformat", "freebayes", "CHROM"]
+    - path: output/snippy/test/test.vcf.gz
+    - path: output/snippy/test/test.vcf.gz.csi
+      md5sum: bed9fa291c220a1ba04eb2d448932ffc
+    - path: output/snippy/versions.yml
+      md5sum: 518aad56c4dbefb6cbcde5ab38cf7b5d

tests/modules/star/align/test.yml

@@ -36,7 +36,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: b9f5e2f6a624b64c300fe25dc3ac801f
+      md5sum: 63de6af2210e138b49d7b4d570c6e67f
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -80,7 +80,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: 38d08f0b944a2a1b981a250d675aa0d9
+      md5sum: 7cdef439bc8092bfefb4d091bf8ee6ab
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -124,7 +124,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: c740d5177067c1fcc48ab7a16cd639d7
+      md5sum: 5dbc36fce7b72628c809bbc7d3d67973
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -168,9 +168,9 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: a1bd1b40950a58ea2776908076160052
+      md5sum: d85858bf55a523121dde762046a34c5c
     - path: output/star/test.Chimeric.out.junction
-      md5sum: 327629eb54032212f29e1c32cbac6975
+      md5sum: ae87d1a24180f5a35cf6b47fdfdd0539
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out

tests/modules/untar/main.nf

@@ -12,3 +12,13 @@ workflow test_untar {
 
     UNTAR ( input )
 }
+
+
+workflow test_untar_different_output_path {
+    input = [
+        [],
+        file(params.test_data['homo_sapiens']['illumina']['test_flowcell'], checkIfExists: true)
+    ]
+
+    UNTAR ( input )
+}

tests/modules/untar/test.yml

@@ -1,5 +1,5 @@
-- name: untar
+- name: untar test_untar
-  command: nextflow run ./tests/modules/untar -entry test_untar -c ./tests/config/nextflow.config -c ./tests/modules/untar/nextflow.config
+  command: nextflow run ./tests/modules/untar -entry test_untar -c ./tests/config/nextflow.config  -c ./tests/modules/untar/nextflow.config
   tags:
     - untar
   files:
@@ -9,3 +9,11 @@
       md5sum: a033d00cf6759407010b21700938f543
     - path: output/untar/kraken2/taxo.k2d
       md5sum: 094d5891cdccf2f1468088855c214b2c
+
+- name: untar test_untar_different_output_path
+  command: nextflow run ./tests/modules/untar -entry test_untar_different_output_path -c ./tests/config/nextflow.config  -c ./tests/modules/untar/nextflow.config
+  tags:
+    - untar
+  files:
+    - path: output/untar/flowcell/RunInfo.xml
+      md5sum: 03038959f4dd181c86bc97ae71fe270a

tests/modules/vsearch/usearchglobal/main.nf

@@ -0,0 +1,25 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
+
+workflow test_vsearch_usearchglobal {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "xcfert"  // Nonsense text to check default case.
+    columns = "" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}
+
+workflow test_vsearch_usearchglobal_userout {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "userout"
+    columns = "query+target+id" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}

tests/modules/vsearch/usearchglobal/nextflow.config

@@ -0,0 +1,4 @@
+process {
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+} 
+

tests/modules/vsearch/usearchglobal/test.yml

@@ -0,0 +1,26 @@
+- name: vsearch usearchglobal test_vsearch_usearchglobal
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.aln
+      contains:
+        - "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
+        - "Query >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "%Id   TLen  Target"
+        - "100%  29829  MT192765.1"
+        - "Query  3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "Target 29829nt >MT192765.1"
+        - "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
+        - "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
+        - "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
+
+- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.tsv
+      md5sum: b6cc50f7c8d18cb82e74dab70ed4baab