Merge remote-tracking branch 'upstream/master' into gatk_spark

modules/bamtools/convert/meta.yml

@@ -42,7 +42,6 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-  ## TODO nf-core: Delete / customise this example output
   - out:
       type: file
       description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml)

modules/mash/screen/main.nf

@@ -8,8 +8,8 @@ process MASH_SCREEN {
         'quay.io/biocontainers/mash:2.3--he348c14_1' }"
 
     input:
-    tuple val(meta), path(query_sketch)
+    tuple val(meta), path(query)
-    path fastx_db
+    path sequences_sketch
 
     output:
     tuple val(meta), path("*.screen"), emit: screen
@@ -26,8 +26,8 @@ process MASH_SCREEN {
         screen \\
         $args \\
         -p $task.cpus \\
-        $query_sketch \\
+        $sequences_sketch \\
-        $fastx_db \\
+        $query \\
         > ${prefix}.screen
 
     cat <<-END_VERSIONS > versions.yml

modules/mash/screen/meta.yml

@@ -20,13 +20,14 @@ input:
       description: |
         Groovy Map containing sample information
         e.g. [ id:'test', single_end:false ]
-  - query_sketch:
+  - query:
       type: file
-      description: MinHash sketch of query sequences
+      description: Query sequences
-      pattern: "*.msh"
+      pattern: "*.fastq.gz"
-  - fastx_db:
+  - sequence_sketch:
       type: file
       description: Sequence files to match against
+      pattern: "*.msh"
 
 output:
   - meta:

modules/mosdepth/main.nf

@@ -13,15 +13,19 @@ process MOSDEPTH {
     path  fasta
 
     output:
-    tuple val(meta), path('*.global.dist.txt')    , emit: global_txt
+    tuple val(meta), path('*.global.dist.txt')      , emit: global_txt
-    tuple val(meta), path('*.region.dist.txt')    , emit: regions_txt , optional:true
+    tuple val(meta), path('*.summary.txt')          , emit: summary_txt
-    tuple val(meta), path('*.summary.txt')        , emit: summary_txt
+    tuple val(meta), path('*.region.dist.txt')      , optional:true, emit: regions_txt
-    tuple val(meta), path('*.per-base.d4')        , emit: per_base_d4 , optional:true
+    tuple val(meta), path('*.per-base.d4')          , optional:true, emit: per_base_d4
-    tuple val(meta), path('*.per-base.bed.gz')    , emit: per_base_bed, optional:true
+    tuple val(meta), path('*.per-base.bed.gz')      , optional:true, emit: per_base_bed
-    tuple val(meta), path('*.per-base.bed.gz.csi'), emit: per_base_csi, optional:true
+    tuple val(meta), path('*.per-base.bed.gz.csi')  , optional:true, emit: per_base_csi
-    tuple val(meta), path('*.regions.bed.gz')     , emit: regions_bed , optional:true
+    tuple val(meta), path('*.regions.bed.gz')       , optional:true, emit: regions_bed
-    tuple val(meta), path('*.regions.bed.gz.csi') , emit: regions_csi , optional:true
+    tuple val(meta), path('*.regions.bed.gz.csi')   , optional:true, emit: regions_csi
-    path  "versions.yml"                          , emit: versions
+    tuple val(meta), path('*.quantized.bed.gz')     , optional:true, emit: quantized_bed
+    tuple val(meta), path('*.quantized.bed.gz.csi') , optional:true, emit: quantized_csi
+    tuple val(meta), path('*.thresholds.bed.gz')    , optional:true, emit: thresholds_bed
+    tuple val(meta), path('*.thresholds.bed.gz.csi'), optional:true, emit: thresholds_csi
+    path  "versions.yml"                            , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -34,10 +38,13 @@ process MOSDEPTH {
     if (bed && args.contains("--by")) {
         exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
     }
+    if (!bed && args.contains("--thresholds")) {
+        exit 1, "'--thresholds' can only be specified in conjunction with '--by'"
+    }
 
     """
     mosdepth \\
-        --threads ${task.cpus} \\
+        --threads $task.cpus \\
         $interval \\
         $reference \\
         $args \\
@@ -61,6 +68,10 @@ process MOSDEPTH {
     touch ${prefix}.per-base.bed.gz.csi
     touch ${prefix}.regions.bed.gz
     touch ${prefix}.regions.bed.gz.csi
+    touch ${prefix}.quantized.bed.gz
+    touch ${prefix}.quantized.bed.gz.csi
+    touch ${prefix}.thresholds.bed.gz
+    touch ${prefix}.thresholds.bed.gz.csi
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

modules/mosdepth/meta.yml

@@ -72,6 +72,22 @@ output:
       type: file
       description: Index file for BED file with per-region coverage
       pattern: "*.{regions.bed.gz.csi}"
+  - quantized_bed:
+      type: file
+      description: BED file with binned coverage
+      pattern: "*.{quantized.bed.gz}"
+  - quantized_csi:
+      type: file
+      description: Index file for BED file with binned coverage
+      pattern: "*.{quantized.bed.gz.csi}"
+  - thresholds_bed:
+      type: file
+      description: BED file with the number of bases in each region that are covered at or above each threshold
+      pattern: "*.{thresholds.bed.gz}"
+  - thresholds_csi:
+      type: file
+      description: Index file for BED file with threshold coverage
+      pattern: "*.{thresholds.bed.gz.csi}"
   - versions:
       type: file
       description: File containing software versions

modules/star/align/main.nf

@@ -2,16 +2,15 @@ process STAR_ALIGN {
     tag "$meta.id"
     label 'process_high'
 
-    // Note: 2.7X indices incompatible with AWS iGenomes.
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
-    conda (params.enable_conda ? 'bioconda::star=2.7.9a' : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/star:2.7.9a--h9ee0642_0' :
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
-        'quay.io/biocontainers/star:2.7.9a--h9ee0642_0' }"
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
 
     input:
     tuple val(meta), path(reads)
-    path  index
+    path index
-    path  gtf
+    path gtf
     val star_ignore_sjdbgtf
     val seq_platform
     val seq_center
@@ -67,6 +66,8 @@ process STAR_ALIGN {
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         star: \$(STAR --version | sed -e "s/STAR_//g")
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+        gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
     END_VERSIONS
     """
 }

modules/star/genomegenerate/main.nf

@@ -2,19 +2,18 @@ process STAR_GENOMEGENERATE {
     tag "$fasta"
     label 'process_high'
 
-    // Note: 2.7X indices incompatible with AWS iGenomes.
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
-    conda (params.enable_conda ? "bioconda::star=2.7.9a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' :
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
-        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' }"
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
 
     input:
     path fasta
     path gtf
 
     output:
-    path "star"         , emit: index
+    path "star"        , emit: index
-    path "versions.yml" , emit: versions
+    path "versions.yml", emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -22,7 +21,7 @@ process STAR_GENOMEGENERATE {
     script:
     def args = task.ext.args ?: ''
     def args_list = args.tokenize()
-    def memory   = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
+    def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
     if (args_list.contains('--genomeSAindexNbases')) {
         """
         mkdir star

modules/vsearch/usearchglobal/main.nf

@@ -0,0 +1,67 @@
+process VSEARCH_USEARCHGLOBAL {
+    tag "${meta.id}"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
+        'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
+
+    input:
+    tuple val(meta), path(queryfasta)
+    path db
+    val idcutoff
+    val outoption
+    val user_columns
+
+    output:
+    tuple val(meta), path('*.aln')    , optional: true, emit: aln
+    tuple val(meta), path('*.biom')   , optional: true, emit: biom
+    tuple val(meta), path('*.lca')    , optional: true, emit: lca
+    tuple val(meta), path('*.mothur') , optional: true, emit: mothur
+    tuple val(meta), path('*.otu')    , optional: true, emit: otu
+    tuple val(meta), path('*.sam')    , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')    , optional: true, emit: tsv
+    tuple val(meta), path('*.txt')    , optional: true, emit: txt
+    tuple val(meta), path('*.uc')     , optional: true, emit: uc
+    path "versions.yml"                               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def columns = user_columns ? "--userfields ${user_columns}" : ''
+    switch ( outoption ) {
+        case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
+        case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
+        case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
+        case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
+        case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+        case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+        case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
+        case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
+        default:
+            outfmt = "--alnout";
+            out_ext = 'aln';
+            log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
+            break
+    }
+    """
+    vsearch \\
+        --usearch_global $queryfasta \\
+        --db $db \\
+        --id $idcutoff \\
+        --threads $task.cpus \\
+        $args \\
+        ${columns} \\
+        ${outfmt} ${prefix}.${out_ext}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
+    END_VERSIONS
+    """
+}

modules/vsearch/usearchglobal/meta.yml

@@ -0,0 +1,83 @@
+name: "vsearch_usearchglobal"
+description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
+keywords:
+  - vsearch
+  - usearch
+  - alignment
+  - fasta
+tools:
+  - "vsearch":
+      description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
+      homepage: "https://github.com/torognes/vsearch"
+      documentation: "None"
+      tool_dev_url: "https://github.com/torognes/vsearch"
+      doi: "doi: 10.7717/peerj.2584"
+      licence: "['GPL v3-or-later OR BSD-2-clause']"
+
+input:
+  - meta:
+      type: map
+      description: Groovy Map containing sample information e.g. [ id:'test' ]
+  - queryfasta:
+      type: file
+      description: Query sequences in FASTA format
+      pattern: "*.{fasta,fa,fna,faa}"
+  - db:
+      type: file
+      description: Reference database file in FASTA or UDB format
+      pattern: "*"
+  - idcutoff:
+      type: real
+      description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
+  - outoption:
+      type: string
+      description: Specify the type of output file to be generated by selecting one of the vsearch output file options
+      pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
+  - user_columns:
+      type: string
+      description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
+
+output:
+  - aln:
+      type: file
+      description: Results in pairwise alignment format
+      pattern: "*.{aln}"
+  - biom:
+      type: file
+      description: Results in an OTU table in the biom version 1.0 file format
+      pattern: "*.{biom}"
+  - lca:
+      type: file
+      description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
+      pattern: "*.{lca}"
+  - mothur:
+      type: file
+      description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format
+      pattern: "*.{mothur}"
+  - otu:
+      type: file
+      description: Results in an OTU table in the classic tab-separated plain text format
+      pattern: "*.{otu}"
+  - sam:
+      type: file
+      description: Results written in sam format
+      pattern: "*.{sam}"
+  - tsv:
+      type: file
+      description: Results in tab-separated output, columns defined by user
+      pattern: "*.{tsv}"
+  - txt:
+      type: file
+      description: Tab delimited results in blast-like tabular format
+      pattern: "*.{txt}"
+  - uc:
+      type: file
+      description: Tab delimited results in a uclust-like format with 10 columns
+      pattern: "*.{uc}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+
+authors:
+  - "@jtangrot"

tests/config/pytest_modules.yml

@@ -2052,6 +2052,10 @@ vcftools:
   - modules/vcftools/**
   - tests/modules/vcftools/**
 
+vsearch/usearchglobal:
+  - modules/vsearch/usearchglobal/**
+  - tests/modules/vsearch/usearchglobal/**
+
 yara/index:
   - modules/yara/index/**
   - tests/modules/yara/index/**

tests/modules/mash/screen/main.nf

@@ -14,8 +14,11 @@ workflow test_mash_screen {
             file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
         ]
     ]
-    fastx_db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    sars_db = [
+        [ id: 'sars_db' ],
+        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    ]
 
-    MASH_SKETCH ( input )
+    MASH_SKETCH ( sars_db )
-    MASH_SCREEN ( MASH_SKETCH.out.mash, fastx_db )
+    MASH_SCREEN ( input, MASH_SKETCH.out.mash.map { meta, sketch -> sketch } )
 }

tests/modules/mash/screen/test.yml

@@ -4,9 +4,9 @@
     - mash
     - mash/screen
   files:
-    - path: output/mash/test.mash_stats
+    - path: output/mash/sars_db.mash_stats
-      md5sum: 2a6f297d8e69a5e4160243bc6c89129c
+      md5sum: 1dafbd23e36e18bf4c87a007d0fc98f7
-    - path: output/mash/test.msh
+    - path: output/mash/sars_db.msh
-      md5sum: d747145a43dad5f82342036f8f5d9133
+      md5sum: 24289e4a13526e88eeb2abfca4a0f0a8
     - path: output/mash/test.screen
-      md5sum: d3c871dccd5cd57ab54781fa5c5d7278
+      md5sum: ac8701e1aab651b2f36c6380b1351b11

tests/modules/mosdepth/main.nf

@@ -2,72 +2,95 @@
 
 nextflow.enable.dsl = 2
 
-include { MOSDEPTH                    } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH                       } from '../../../modules/mosdepth/main.nf'
-include { MOSDEPTH as MOSDEPTH_FAIL   } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_FAIL      } from '../../../modules/mosdepth/main.nf'
-include { MOSDEPTH as MOSDEPTH_WINDOW } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_WINDOW    } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_THRESHOLD } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_QUANTIZED } from '../../../modules/mosdepth/main.nf'
 
 workflow test_mosdepth {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
 
     MOSDEPTH ( input, [], [] )
 }
 
 workflow test_mosdepth_bed {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH ( input, bed, [] )
 }
 
 workflow test_mosdepth_cram {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
-            ]
+    ]
-    fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
 
     MOSDEPTH ( input, [], fasta )
 }
 
 workflow test_mosdepth_cram_bed {
     input  = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
-    fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
 
     MOSDEPTH ( input, bed, fasta )
 }
 
 workflow test_mosdepth_window {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH_WINDOW ( input, [], [] )
 }
 
+workflow test_mosdepth_quantized {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+
+    MOSDEPTH_QUANTIZED ( input, [], [] )
+}
+
+workflow test_mosdepth_thresholds {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+
+    MOSDEPTH_THRESHOLD ( input, bed, [] )
+}
+
 workflow test_mosdepth_fail {
-    input  = [
+    input = [
-                [ id:'test', single_end:true ],
+        [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
-            ]
+    ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH_FAIL ( input, bed, [] )
 }

tests/modules/mosdepth/nextflow.config

@@ -7,4 +7,10 @@ process {
     withName: MOSDEPTH_WINDOW {
         ext.args = "--by 100"
     }
+    withName: MOSDEPTH_QUANTIZED {
+        ext.args = "--quantize 0:1:4:100:200"
+    }
+    withName: MOSDEPTH_THRESHOLD {
+        ext.args = "--thresholds 1,10,20,30"
+    }
 }

tests/modules/mosdepth/test.yml

@@ -86,6 +86,48 @@
     - path: output/mosdepth/test.regions.bed.gz.csi
       md5sum: 257d67678136963d9dd904330079609d
 
+- name: mosdepth test_mosdepth_quantized
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_quantized -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 4f0d231060cbde4efdd673863bd2fb59
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.quantized.bed.gz
+      md5sum: 3e434a8bafcf59a67841ae3d4d752838
+    - path: output/mosdepth/test.quantized.bed.gz.csi
+      md5sum: be9617f551f19a33923f1e886eaefb93
+
+- name: mosdepth test_mosdepth_thresholds
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_thresholds -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.region.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 96c037f769974b904beb53edc4f56d82
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.regions.bed.gz
+      md5sum: 5d398caf7171ec4406278e2add3009ae
+    - path: output/mosdepth/test.regions.bed.gz.csi
+      md5sum: 47669cfe41f3e222e74d81e1b1be191f
+    - path: output/mosdepth/test.thresholds.bed.gz
+      md5sum: 13101e326eea3cbfa1d569b69f494f4c
+    - path: output/mosdepth/test.thresholds.bed.gz.csi
+      md5sum: 912055ee9452229439df6fae95644196
+
 - name: mosdepth test_mosdepth_fail
   command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_fail -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
   tags:

tests/modules/star/align/test.yml

@@ -36,7 +36,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: b9f5e2f6a624b64c300fe25dc3ac801f
+      md5sum: 63de6af2210e138b49d7b4d570c6e67f
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -80,7 +80,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: 38d08f0b944a2a1b981a250d675aa0d9
+      md5sum: 7cdef439bc8092bfefb4d091bf8ee6ab
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -124,7 +124,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: c740d5177067c1fcc48ab7a16cd639d7
+      md5sum: 5dbc36fce7b72628c809bbc7d3d67973
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -168,9 +168,9 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: a1bd1b40950a58ea2776908076160052
+      md5sum: d85858bf55a523121dde762046a34c5c
     - path: output/star/test.Chimeric.out.junction
-      md5sum: 327629eb54032212f29e1c32cbac6975
+      md5sum: ae87d1a24180f5a35cf6b47fdfdd0539
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out

tests/modules/vsearch/usearchglobal/main.nf

@@ -0,0 +1,25 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
+
+workflow test_vsearch_usearchglobal {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "xcfert"  // Nonsense text to check default case.
+    columns = "" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}
+
+workflow test_vsearch_usearchglobal_userout {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "userout"
+    columns = "query+target+id" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}

tests/modules/vsearch/usearchglobal/nextflow.config

@@ -0,0 +1,4 @@
+process {
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+} 
+

tests/modules/vsearch/usearchglobal/test.yml

@@ -0,0 +1,26 @@
+- name: vsearch usearchglobal test_vsearch_usearchglobal
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.aln
+      contains:
+        - "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
+        - "Query >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "%Id   TLen  Target"
+        - "100%  29829  MT192765.1"
+        - "Query  3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "Target 29829nt >MT192765.1"
+        - "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
+        - "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
+        - "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
+
+- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.tsv
+      md5sum: b6cc50f7c8d18cb82e74dab70ed4baab