mirror of
https://github.com/MillironX/nf-core_modules.git
synced 2024-12-22 11:08:17 +00:00
Merge remote-tracking branch 'upstream/master' into gatk_spark
This commit is contained in:
commit
1e396d767f
19 changed files with 393 additions and 83 deletions
|
@ -42,7 +42,6 @@ output:
|
|||
type: file
|
||||
description: File containing software versions
|
||||
pattern: "versions.yml"
|
||||
## TODO nf-core: Delete / customise this example output
|
||||
- out:
|
||||
type: file
|
||||
description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml)
|
||||
|
|
|
@ -8,8 +8,8 @@ process MASH_SCREEN {
|
|||
'quay.io/biocontainers/mash:2.3--he348c14_1' }"
|
||||
|
||||
input:
|
||||
tuple val(meta), path(query_sketch)
|
||||
path fastx_db
|
||||
tuple val(meta), path(query)
|
||||
path sequences_sketch
|
||||
|
||||
output:
|
||||
tuple val(meta), path("*.screen"), emit: screen
|
||||
|
@ -26,8 +26,8 @@ process MASH_SCREEN {
|
|||
screen \\
|
||||
$args \\
|
||||
-p $task.cpus \\
|
||||
$query_sketch \\
|
||||
$fastx_db \\
|
||||
$sequences_sketch \\
|
||||
$query \\
|
||||
> ${prefix}.screen
|
||||
|
||||
cat <<-END_VERSIONS > versions.yml
|
||||
|
|
|
@ -20,13 +20,14 @@ input:
|
|||
description: |
|
||||
Groovy Map containing sample information
|
||||
e.g. [ id:'test', single_end:false ]
|
||||
- query_sketch:
|
||||
- query:
|
||||
type: file
|
||||
description: MinHash sketch of query sequences
|
||||
pattern: "*.msh"
|
||||
- fastx_db:
|
||||
description: Query sequences
|
||||
pattern: "*.fastq.gz"
|
||||
- sequence_sketch:
|
||||
type: file
|
||||
description: Sequence files to match against
|
||||
pattern: "*.msh"
|
||||
|
||||
output:
|
||||
- meta:
|
||||
|
|
|
@ -13,15 +13,19 @@ process MOSDEPTH {
|
|||
path fasta
|
||||
|
||||
output:
|
||||
tuple val(meta), path('*.global.dist.txt') , emit: global_txt
|
||||
tuple val(meta), path('*.region.dist.txt') , emit: regions_txt , optional:true
|
||||
tuple val(meta), path('*.summary.txt') , emit: summary_txt
|
||||
tuple val(meta), path('*.per-base.d4') , emit: per_base_d4 , optional:true
|
||||
tuple val(meta), path('*.per-base.bed.gz') , emit: per_base_bed, optional:true
|
||||
tuple val(meta), path('*.per-base.bed.gz.csi'), emit: per_base_csi, optional:true
|
||||
tuple val(meta), path('*.regions.bed.gz') , emit: regions_bed , optional:true
|
||||
tuple val(meta), path('*.regions.bed.gz.csi') , emit: regions_csi , optional:true
|
||||
path "versions.yml" , emit: versions
|
||||
tuple val(meta), path('*.global.dist.txt') , emit: global_txt
|
||||
tuple val(meta), path('*.summary.txt') , emit: summary_txt
|
||||
tuple val(meta), path('*.region.dist.txt') , optional:true, emit: regions_txt
|
||||
tuple val(meta), path('*.per-base.d4') , optional:true, emit: per_base_d4
|
||||
tuple val(meta), path('*.per-base.bed.gz') , optional:true, emit: per_base_bed
|
||||
tuple val(meta), path('*.per-base.bed.gz.csi') , optional:true, emit: per_base_csi
|
||||
tuple val(meta), path('*.regions.bed.gz') , optional:true, emit: regions_bed
|
||||
tuple val(meta), path('*.regions.bed.gz.csi') , optional:true, emit: regions_csi
|
||||
tuple val(meta), path('*.quantized.bed.gz') , optional:true, emit: quantized_bed
|
||||
tuple val(meta), path('*.quantized.bed.gz.csi') , optional:true, emit: quantized_csi
|
||||
tuple val(meta), path('*.thresholds.bed.gz') , optional:true, emit: thresholds_bed
|
||||
tuple val(meta), path('*.thresholds.bed.gz.csi'), optional:true, emit: thresholds_csi
|
||||
path "versions.yml" , emit: versions
|
||||
|
||||
when:
|
||||
task.ext.when == null || task.ext.when
|
||||
|
@ -34,10 +38,13 @@ process MOSDEPTH {
|
|||
if (bed && args.contains("--by")) {
|
||||
exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
|
||||
}
|
||||
if (!bed && args.contains("--thresholds")) {
|
||||
exit 1, "'--thresholds' can only be specified in conjunction with '--by'"
|
||||
}
|
||||
|
||||
"""
|
||||
mosdepth \\
|
||||
--threads ${task.cpus} \\
|
||||
--threads $task.cpus \\
|
||||
$interval \\
|
||||
$reference \\
|
||||
$args \\
|
||||
|
@ -61,6 +68,10 @@ process MOSDEPTH {
|
|||
touch ${prefix}.per-base.bed.gz.csi
|
||||
touch ${prefix}.regions.bed.gz
|
||||
touch ${prefix}.regions.bed.gz.csi
|
||||
touch ${prefix}.quantized.bed.gz
|
||||
touch ${prefix}.quantized.bed.gz.csi
|
||||
touch ${prefix}.thresholds.bed.gz
|
||||
touch ${prefix}.thresholds.bed.gz.csi
|
||||
|
||||
cat <<-END_VERSIONS > versions.yml
|
||||
"${task.process}":
|
||||
|
|
|
@ -72,6 +72,22 @@ output:
|
|||
type: file
|
||||
description: Index file for BED file with per-region coverage
|
||||
pattern: "*.{regions.bed.gz.csi}"
|
||||
- quantized_bed:
|
||||
type: file
|
||||
description: BED file with binned coverage
|
||||
pattern: "*.{quantized.bed.gz}"
|
||||
- quantized_csi:
|
||||
type: file
|
||||
description: Index file for BED file with binned coverage
|
||||
pattern: "*.{quantized.bed.gz.csi}"
|
||||
- thresholds_bed:
|
||||
type: file
|
||||
description: BED file with the number of bases in each region that are covered at or above each threshold
|
||||
pattern: "*.{thresholds.bed.gz}"
|
||||
- thresholds_csi:
|
||||
type: file
|
||||
description: Index file for BED file with threshold coverage
|
||||
pattern: "*.{thresholds.bed.gz.csi}"
|
||||
- versions:
|
||||
type: file
|
||||
description: File containing software versions
|
||||
|
|
|
@ -2,16 +2,15 @@ process STAR_ALIGN {
|
|||
tag "$meta.id"
|
||||
label 'process_high'
|
||||
|
||||
// Note: 2.7X indices incompatible with AWS iGenomes.
|
||||
conda (params.enable_conda ? 'bioconda::star=2.7.9a' : null)
|
||||
conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
|
||||
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
|
||||
'https://depot.galaxyproject.org/singularity/star:2.7.9a--h9ee0642_0' :
|
||||
'quay.io/biocontainers/star:2.7.9a--h9ee0642_0' }"
|
||||
'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
|
||||
'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
|
||||
|
||||
input:
|
||||
tuple val(meta), path(reads)
|
||||
path index
|
||||
path gtf
|
||||
path index
|
||||
path gtf
|
||||
val star_ignore_sjdbgtf
|
||||
val seq_platform
|
||||
val seq_center
|
||||
|
@ -67,6 +66,8 @@ process STAR_ALIGN {
|
|||
cat <<-END_VERSIONS > versions.yml
|
||||
"${task.process}":
|
||||
star: \$(STAR --version | sed -e "s/STAR_//g")
|
||||
samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
|
||||
gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
|
||||
END_VERSIONS
|
||||
"""
|
||||
}
|
||||
|
|
|
@ -2,19 +2,18 @@ process STAR_GENOMEGENERATE {
|
|||
tag "$fasta"
|
||||
label 'process_high'
|
||||
|
||||
// Note: 2.7X indices incompatible with AWS iGenomes.
|
||||
conda (params.enable_conda ? "bioconda::star=2.7.9a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
|
||||
conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
|
||||
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
|
||||
'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' :
|
||||
'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' }"
|
||||
'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
|
||||
'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
|
||||
|
||||
input:
|
||||
path fasta
|
||||
path gtf
|
||||
|
||||
output:
|
||||
path "star" , emit: index
|
||||
path "versions.yml" , emit: versions
|
||||
path "star" , emit: index
|
||||
path "versions.yml", emit: versions
|
||||
|
||||
when:
|
||||
task.ext.when == null || task.ext.when
|
||||
|
@ -22,7 +21,7 @@ process STAR_GENOMEGENERATE {
|
|||
script:
|
||||
def args = task.ext.args ?: ''
|
||||
def args_list = args.tokenize()
|
||||
def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
|
||||
def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
|
||||
if (args_list.contains('--genomeSAindexNbases')) {
|
||||
"""
|
||||
mkdir star
|
||||
|
|
67
modules/vsearch/usearchglobal/main.nf
Normal file
67
modules/vsearch/usearchglobal/main.nf
Normal file
|
@ -0,0 +1,67 @@
|
|||
process VSEARCH_USEARCHGLOBAL {
|
||||
tag "${meta.id}"
|
||||
label 'process_low'
|
||||
|
||||
conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
|
||||
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
|
||||
'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
|
||||
'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
|
||||
|
||||
input:
|
||||
tuple val(meta), path(queryfasta)
|
||||
path db
|
||||
val idcutoff
|
||||
val outoption
|
||||
val user_columns
|
||||
|
||||
output:
|
||||
tuple val(meta), path('*.aln') , optional: true, emit: aln
|
||||
tuple val(meta), path('*.biom') , optional: true, emit: biom
|
||||
tuple val(meta), path('*.lca') , optional: true, emit: lca
|
||||
tuple val(meta), path('*.mothur') , optional: true, emit: mothur
|
||||
tuple val(meta), path('*.otu') , optional: true, emit: otu
|
||||
tuple val(meta), path('*.sam') , optional: true, emit: sam
|
||||
tuple val(meta), path('*.tsv') , optional: true, emit: tsv
|
||||
tuple val(meta), path('*.txt') , optional: true, emit: txt
|
||||
tuple val(meta), path('*.uc') , optional: true, emit: uc
|
||||
path "versions.yml" , emit: versions
|
||||
|
||||
when:
|
||||
task.ext.when == null || task.ext.when
|
||||
|
||||
script:
|
||||
def args = task.ext.args ?: ''
|
||||
def prefix = task.ext.prefix ?: "${meta.id}"
|
||||
def columns = user_columns ? "--userfields ${user_columns}" : ''
|
||||
switch ( outoption ) {
|
||||
case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
|
||||
case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
|
||||
case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
|
||||
case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
|
||||
case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
|
||||
case "samout": outfmt = "--samout"; out_ext = 'sam'; break
|
||||
case "uc": outfmt = "--uc"; out_ext = 'uc'; break
|
||||
case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
|
||||
case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
|
||||
default:
|
||||
outfmt = "--alnout";
|
||||
out_ext = 'aln';
|
||||
log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
|
||||
break
|
||||
}
|
||||
"""
|
||||
vsearch \\
|
||||
--usearch_global $queryfasta \\
|
||||
--db $db \\
|
||||
--id $idcutoff \\
|
||||
--threads $task.cpus \\
|
||||
$args \\
|
||||
${columns} \\
|
||||
${outfmt} ${prefix}.${out_ext}
|
||||
|
||||
cat <<-END_VERSIONS > versions.yml
|
||||
"${task.process}":
|
||||
vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
|
||||
END_VERSIONS
|
||||
"""
|
||||
}
|
83
modules/vsearch/usearchglobal/meta.yml
Normal file
83
modules/vsearch/usearchglobal/meta.yml
Normal file
|
@ -0,0 +1,83 @@
|
|||
name: "vsearch_usearchglobal"
|
||||
description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
|
||||
keywords:
|
||||
- vsearch
|
||||
- usearch
|
||||
- alignment
|
||||
- fasta
|
||||
tools:
|
||||
- "vsearch":
|
||||
description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
|
||||
homepage: "https://github.com/torognes/vsearch"
|
||||
documentation: "None"
|
||||
tool_dev_url: "https://github.com/torognes/vsearch"
|
||||
doi: "doi: 10.7717/peerj.2584"
|
||||
licence: "['GPL v3-or-later OR BSD-2-clause']"
|
||||
|
||||
input:
|
||||
- meta:
|
||||
type: map
|
||||
description: Groovy Map containing sample information e.g. [ id:'test' ]
|
||||
- queryfasta:
|
||||
type: file
|
||||
description: Query sequences in FASTA format
|
||||
pattern: "*.{fasta,fa,fna,faa}"
|
||||
- db:
|
||||
type: file
|
||||
description: Reference database file in FASTA or UDB format
|
||||
pattern: "*"
|
||||
- idcutoff:
|
||||
type: real
|
||||
description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
|
||||
- outoption:
|
||||
type: string
|
||||
description: Specify the type of output file to be generated by selecting one of the vsearch output file options
|
||||
pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
|
||||
- user_columns:
|
||||
type: string
|
||||
description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
|
||||
|
||||
output:
|
||||
- aln:
|
||||
type: file
|
||||
description: Results in pairwise alignment format
|
||||
pattern: "*.{aln}"
|
||||
- biom:
|
||||
type: file
|
||||
description: Results in an OTU table in the biom version 1.0 file format
|
||||
pattern: "*.{biom}"
|
||||
- lca:
|
||||
type: file
|
||||
description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
|
||||
pattern: "*.{lca}"
|
||||
- mothur:
|
||||
type: file
|
||||
description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format
|
||||
pattern: "*.{mothur}"
|
||||
- otu:
|
||||
type: file
|
||||
description: Results in an OTU table in the classic tab-separated plain text format
|
||||
pattern: "*.{otu}"
|
||||
- sam:
|
||||
type: file
|
||||
description: Results written in sam format
|
||||
pattern: "*.{sam}"
|
||||
- tsv:
|
||||
type: file
|
||||
description: Results in tab-separated output, columns defined by user
|
||||
pattern: "*.{tsv}"
|
||||
- txt:
|
||||
type: file
|
||||
description: Tab delimited results in blast-like tabular format
|
||||
pattern: "*.{txt}"
|
||||
- uc:
|
||||
type: file
|
||||
description: Tab delimited results in a uclust-like format with 10 columns
|
||||
pattern: "*.{uc}"
|
||||
- versions:
|
||||
type: file
|
||||
description: File containing software versions
|
||||
pattern: "versions.yml"
|
||||
|
||||
authors:
|
||||
- "@jtangrot"
|
|
@ -2052,6 +2052,10 @@ vcftools:
|
|||
- modules/vcftools/**
|
||||
- tests/modules/vcftools/**
|
||||
|
||||
vsearch/usearchglobal:
|
||||
- modules/vsearch/usearchglobal/**
|
||||
- tests/modules/vsearch/usearchglobal/**
|
||||
|
||||
yara/index:
|
||||
- modules/yara/index/**
|
||||
- tests/modules/yara/index/**
|
||||
|
|
|
@ -14,8 +14,11 @@ workflow test_mash_screen {
|
|||
file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
|
||||
]
|
||||
]
|
||||
fastx_db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
|
||||
sars_db = [
|
||||
[ id: 'sars_db' ],
|
||||
file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
|
||||
]
|
||||
|
||||
MASH_SKETCH ( input )
|
||||
MASH_SCREEN ( MASH_SKETCH.out.mash, fastx_db )
|
||||
MASH_SKETCH ( sars_db )
|
||||
MASH_SCREEN ( input, MASH_SKETCH.out.mash.map { meta, sketch -> sketch } )
|
||||
}
|
||||
|
|
|
@ -4,9 +4,9 @@
|
|||
- mash
|
||||
- mash/screen
|
||||
files:
|
||||
- path: output/mash/test.mash_stats
|
||||
md5sum: 2a6f297d8e69a5e4160243bc6c89129c
|
||||
- path: output/mash/test.msh
|
||||
md5sum: d747145a43dad5f82342036f8f5d9133
|
||||
- path: output/mash/sars_db.mash_stats
|
||||
md5sum: 1dafbd23e36e18bf4c87a007d0fc98f7
|
||||
- path: output/mash/sars_db.msh
|
||||
md5sum: 24289e4a13526e88eeb2abfca4a0f0a8
|
||||
- path: output/mash/test.screen
|
||||
md5sum: d3c871dccd5cd57ab54781fa5c5d7278
|
||||
md5sum: ac8701e1aab651b2f36c6380b1351b11
|
||||
|
|
|
@ -2,72 +2,95 @@
|
|||
|
||||
nextflow.enable.dsl = 2
|
||||
|
||||
include { MOSDEPTH } from '../../../modules/mosdepth/main.nf'
|
||||
include { MOSDEPTH as MOSDEPTH_FAIL } from '../../../modules/mosdepth/main.nf'
|
||||
include { MOSDEPTH as MOSDEPTH_WINDOW } from '../../../modules/mosdepth/main.nf'
|
||||
include { MOSDEPTH } from '../../../modules/mosdepth/main.nf'
|
||||
include { MOSDEPTH as MOSDEPTH_FAIL } from '../../../modules/mosdepth/main.nf'
|
||||
include { MOSDEPTH as MOSDEPTH_WINDOW } from '../../../modules/mosdepth/main.nf'
|
||||
include { MOSDEPTH as MOSDEPTH_THRESHOLD } from '../../../modules/mosdepth/main.nf'
|
||||
include { MOSDEPTH as MOSDEPTH_QUANTIZED } from '../../../modules/mosdepth/main.nf'
|
||||
|
||||
workflow test_mosdepth {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
|
||||
]
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
|
||||
]
|
||||
|
||||
MOSDEPTH ( input, [], [] )
|
||||
}
|
||||
|
||||
workflow test_mosdepth_bed {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
|
||||
]
|
||||
bed = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
|
||||
]
|
||||
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
|
||||
|
||||
MOSDEPTH ( input, bed, [] )
|
||||
}
|
||||
|
||||
workflow test_mosdepth_cram {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
|
||||
]
|
||||
fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
|
||||
]
|
||||
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
|
||||
|
||||
MOSDEPTH ( input, [], fasta )
|
||||
}
|
||||
|
||||
workflow test_mosdepth_cram_bed {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
|
||||
]
|
||||
bed = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
|
||||
fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
|
||||
]
|
||||
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
|
||||
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
|
||||
|
||||
MOSDEPTH ( input, bed, fasta )
|
||||
}
|
||||
|
||||
workflow test_mosdepth_window {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
|
||||
]
|
||||
bed = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
|
||||
]
|
||||
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
|
||||
|
||||
MOSDEPTH_WINDOW ( input, [], [] )
|
||||
}
|
||||
|
||||
workflow test_mosdepth_quantized {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
|
||||
]
|
||||
|
||||
MOSDEPTH_QUANTIZED ( input, [], [] )
|
||||
}
|
||||
|
||||
workflow test_mosdepth_thresholds {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
|
||||
]
|
||||
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
|
||||
|
||||
MOSDEPTH_THRESHOLD ( input, bed, [] )
|
||||
}
|
||||
|
||||
workflow test_mosdepth_fail {
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
|
||||
[ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
|
||||
]
|
||||
bed = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
|
||||
input = [
|
||||
[ id:'test', single_end:true ],
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
|
||||
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
|
||||
]
|
||||
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
|
||||
|
||||
MOSDEPTH_FAIL ( input, bed, [] )
|
||||
}
|
||||
|
|
|
@ -7,4 +7,10 @@ process {
|
|||
withName: MOSDEPTH_WINDOW {
|
||||
ext.args = "--by 100"
|
||||
}
|
||||
withName: MOSDEPTH_QUANTIZED {
|
||||
ext.args = "--quantize 0:1:4:100:200"
|
||||
}
|
||||
withName: MOSDEPTH_THRESHOLD {
|
||||
ext.args = "--thresholds 1,10,20,30"
|
||||
}
|
||||
}
|
||||
|
|
|
@ -86,6 +86,48 @@
|
|||
- path: output/mosdepth/test.regions.bed.gz.csi
|
||||
md5sum: 257d67678136963d9dd904330079609d
|
||||
|
||||
- name: mosdepth test_mosdepth_quantized
|
||||
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_quantized -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
|
||||
tags:
|
||||
- mosdepth
|
||||
files:
|
||||
- path: output/mosdepth/test.mosdepth.global.dist.txt
|
||||
md5sum: e82e90c7d508a135b5a8a7cd6933452e
|
||||
- path: output/mosdepth/test.mosdepth.summary.txt
|
||||
md5sum: 4f0d231060cbde4efdd673863bd2fb59
|
||||
- path: output/mosdepth/test.per-base.bed.gz
|
||||
md5sum: bc1df47d46f818fee5275975925d769a
|
||||
- path: output/mosdepth/test.per-base.bed.gz.csi
|
||||
md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
|
||||
- path: output/mosdepth/test.quantized.bed.gz
|
||||
md5sum: 3e434a8bafcf59a67841ae3d4d752838
|
||||
- path: output/mosdepth/test.quantized.bed.gz.csi
|
||||
md5sum: be9617f551f19a33923f1e886eaefb93
|
||||
|
||||
- name: mosdepth test_mosdepth_thresholds
|
||||
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_thresholds -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
|
||||
tags:
|
||||
- mosdepth
|
||||
files:
|
||||
- path: output/mosdepth/test.mosdepth.global.dist.txt
|
||||
md5sum: e82e90c7d508a135b5a8a7cd6933452e
|
||||
- path: output/mosdepth/test.mosdepth.region.dist.txt
|
||||
md5sum: e82e90c7d508a135b5a8a7cd6933452e
|
||||
- path: output/mosdepth/test.mosdepth.summary.txt
|
||||
md5sum: 96c037f769974b904beb53edc4f56d82
|
||||
- path: output/mosdepth/test.per-base.bed.gz
|
||||
md5sum: bc1df47d46f818fee5275975925d769a
|
||||
- path: output/mosdepth/test.per-base.bed.gz.csi
|
||||
md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
|
||||
- path: output/mosdepth/test.regions.bed.gz
|
||||
md5sum: 5d398caf7171ec4406278e2add3009ae
|
||||
- path: output/mosdepth/test.regions.bed.gz.csi
|
||||
md5sum: 47669cfe41f3e222e74d81e1b1be191f
|
||||
- path: output/mosdepth/test.thresholds.bed.gz
|
||||
md5sum: 13101e326eea3cbfa1d569b69f494f4c
|
||||
- path: output/mosdepth/test.thresholds.bed.gz.csi
|
||||
md5sum: 912055ee9452229439df6fae95644196
|
||||
|
||||
- name: mosdepth test_mosdepth_fail
|
||||
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_fail -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
|
||||
tags:
|
||||
|
|
|
@ -36,7 +36,7 @@
|
|||
- path: output/star/star/transcriptInfo.tab
|
||||
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
|
||||
- path: output/star/test.Aligned.out.bam
|
||||
md5sum: b9f5e2f6a624b64c300fe25dc3ac801f
|
||||
md5sum: 63de6af2210e138b49d7b4d570c6e67f
|
||||
- path: output/star/test.Log.final.out
|
||||
- path: output/star/test.Log.out
|
||||
- path: output/star/test.Log.progress.out
|
||||
|
@ -80,7 +80,7 @@
|
|||
- path: output/star/star/transcriptInfo.tab
|
||||
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
|
||||
- path: output/star/test.Aligned.out.bam
|
||||
md5sum: 38d08f0b944a2a1b981a250d675aa0d9
|
||||
md5sum: 7cdef439bc8092bfefb4d091bf8ee6ab
|
||||
- path: output/star/test.Log.final.out
|
||||
- path: output/star/test.Log.out
|
||||
- path: output/star/test.Log.progress.out
|
||||
|
@ -124,7 +124,7 @@
|
|||
- path: output/star/star/transcriptInfo.tab
|
||||
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
|
||||
- path: output/star/test.Aligned.out.bam
|
||||
md5sum: c740d5177067c1fcc48ab7a16cd639d7
|
||||
md5sum: 5dbc36fce7b72628c809bbc7d3d67973
|
||||
- path: output/star/test.Log.final.out
|
||||
- path: output/star/test.Log.out
|
||||
- path: output/star/test.Log.progress.out
|
||||
|
@ -168,9 +168,9 @@
|
|||
- path: output/star/star/transcriptInfo.tab
|
||||
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
|
||||
- path: output/star/test.Aligned.out.bam
|
||||
md5sum: a1bd1b40950a58ea2776908076160052
|
||||
md5sum: d85858bf55a523121dde762046a34c5c
|
||||
- path: output/star/test.Chimeric.out.junction
|
||||
md5sum: 327629eb54032212f29e1c32cbac6975
|
||||
md5sum: ae87d1a24180f5a35cf6b47fdfdd0539
|
||||
- path: output/star/test.Log.final.out
|
||||
- path: output/star/test.Log.out
|
||||
- path: output/star/test.Log.progress.out
|
||||
|
|
25
tests/modules/vsearch/usearchglobal/main.nf
Normal file
25
tests/modules/vsearch/usearchglobal/main.nf
Normal file
|
@ -0,0 +1,25 @@
|
|||
#!/usr/bin/env nextflow
|
||||
|
||||
nextflow.enable.dsl = 2
|
||||
|
||||
include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
|
||||
|
||||
workflow test_vsearch_usearchglobal {
|
||||
|
||||
query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
|
||||
db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
|
||||
idcutoff = 0.985
|
||||
outoption = "xcfert" // Nonsense text to check default case.
|
||||
columns = ""
|
||||
VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
|
||||
}
|
||||
|
||||
workflow test_vsearch_usearchglobal_userout {
|
||||
|
||||
query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
|
||||
db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
|
||||
idcutoff = 0.985
|
||||
outoption = "userout"
|
||||
columns = "query+target+id"
|
||||
VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
|
||||
}
|
4
tests/modules/vsearch/usearchglobal/nextflow.config
Normal file
4
tests/modules/vsearch/usearchglobal/nextflow.config
Normal file
|
@ -0,0 +1,4 @@
|
|||
process {
|
||||
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
|
||||
}
|
||||
|
26
tests/modules/vsearch/usearchglobal/test.yml
Normal file
26
tests/modules/vsearch/usearchglobal/test.yml
Normal file
|
@ -0,0 +1,26 @@
|
|||
- name: vsearch usearchglobal test_vsearch_usearchglobal
|
||||
command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
|
||||
tags:
|
||||
- vsearch/usearchglobal
|
||||
- vsearch
|
||||
files:
|
||||
- path: output/vsearch/test.aln
|
||||
contains:
|
||||
- "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
|
||||
- "Query >lcl|MT192765.1_cds_QIK50427.1_2"
|
||||
- "%Id TLen Target"
|
||||
- "100% 29829 MT192765.1"
|
||||
- "Query 3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
|
||||
- "Target 29829nt >MT192765.1"
|
||||
- "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
|
||||
- "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
|
||||
- "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
|
||||
|
||||
- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
|
||||
command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
|
||||
tags:
|
||||
- vsearch/usearchglobal
|
||||
- vsearch
|
||||
files:
|
||||
- path: output/vsearch/test.tsv
|
||||
md5sum: b6cc50f7c8d18cb82e74dab70ed4baab
|
Loading…
Reference in a new issue