Merge branch 'master' into rp3-add-snippy

This commit is contained in:
Robert A. Petit III 2022-06-03 13:01:05 -06:00 committed by GitHub
commit 24ca2ed464
No known key found for this signature in database
GPG key ID: 4AEE18F83AFDEB23
63 changed files with 1136 additions and 185 deletions

View file

@ -42,7 +42,6 @@ output:
type: file type: file
description: File containing software versions description: File containing software versions
pattern: "versions.yml" pattern: "versions.yml"
## TODO nf-core: Delete / customise this example output
- out: - out:
type: file type: file
description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml) description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml)

View file

@ -8,7 +8,7 @@ process BCFTOOLS_CONCAT {
'quay.io/biocontainers/bcftools:1.14--h88f3f91_0' }" 'quay.io/biocontainers/bcftools:1.14--h88f3f91_0' }"
input: input:
tuple val(meta), path(vcfs) tuple val(meta), path(vcfs), path(tbi)
output: output:
tuple val(meta), path("*.gz"), emit: vcf tuple val(meta), path("*.gz"), emit: vcf

View file

@ -25,6 +25,11 @@ input:
description: | description: |
List containing 2 or more vcf files List containing 2 or more vcf files
e.g. [ 'file1.vcf', 'file2.vcf' ] e.g. [ 'file1.vcf', 'file2.vcf' ]
- tbi:
type: files
description: |
List containing 2 or more index files (optional)
e.g. [ 'file1.tbi', 'file2.tbi' ]
output: output:
- meta: - meta:
type: map type: map

View file

@ -10,6 +10,7 @@ process CNVKIT_BATCH {
input: input:
tuple val(meta), path(tumor), path(normal) tuple val(meta), path(tumor), path(normal)
path fasta path fasta
path fasta_fai
path targets path targets
path reference path reference
@ -28,48 +29,167 @@ process CNVKIT_BATCH {
script: script:
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
// execute samtools only when cram files are input, cnvkit runs natively on bam but is prohibitively slow def tumor_exists = tumor ? true : false
// input pair is assumed to have same extension if both exist def normal_exists = normal ? true : false
def is_cram = tumor.Extension == "cram" ? true : false
def tumor_out = is_cram ? tumor.BaseName + ".bam" : "${tumor}" // execute samtools only when cram files are input, cnvkit runs natively on bam but is prohibitively slow
def tumor_cram = tumor_exists && tumor.Extension == "cram" ? true : false
def normal_cram = normal_exists && normal.Extension == "cram" ? true : false
def tumor_bam = tumor_exists && tumor.Extension == "bam" ? true : false
def normal_bam = normal_exists && normal.Extension == "bam" ? true : false
def tumor_out = tumor_cram ? tumor.BaseName + ".bam" : "${tumor}"
// do not run samtools on normal samples in tumor_only mode
def normal_exists = normal ? true: false
// tumor_only mode does not need fasta & target // tumor_only mode does not need fasta & target
// instead it requires a pre-computed reference.cnn which is built from fasta & target // instead it requires a pre-computed reference.cnn which is built from fasta & target
def (normal_out, normal_args, fasta_args) = ["", "", ""] def (normal_out, normal_args, fasta_args) = ["", "", ""]
def fai_reference = fasta_fai ? "--fai-reference ${fasta_fai}" : ""
if (normal_exists){ if (normal_exists){
def normal_prefix = normal.BaseName def normal_prefix = normal.BaseName
normal_out = is_cram ? "${normal_prefix}" + ".bam" : "${normal}" normal_out = normal_cram ? "${normal_prefix}" + ".bam" : "${normal}"
normal_args = normal_prefix ? "--normal $normal_out" : ""
fasta_args = fasta ? "--fasta $fasta" : "" fasta_args = fasta ? "--fasta $fasta" : ""
// germline mode
// normal samples must be input without a flag
// requires flag --normal to be empty []
if(!tumor_exists){
tumor_out = "${normal_prefix}" + ".bam"
normal_args = "--normal "
}
// somatic mode
else {
normal_args = normal_prefix ? "--normal $normal_out" : ""
}
} }
def target_args = targets ? "--targets $targets" : "" def target_args = targets ? "--targets $targets" : ""
def reference_args = reference ? "--reference $reference" : "" def reference_args = reference ? "--reference $reference" : ""
""" // somatic_mode cram_input
if $is_cram; then if (tumor_cram && normal_cram){
samtools view -T $fasta $tumor -@ $task.cpus -o $tumor_out """
if $normal_exists; then samtools view -T $fasta $fai_reference $tumor -@ $task.cpus -o $tumor_out
samtools view -T $fasta $normal -@ $task.cpus -o $normal_out samtools view -T $fasta $fai_reference $normal -@ $task.cpus -o $normal_out
fi
fi
cnvkit.py \\ cnvkit.py \\
batch \\ batch \\
$tumor_out \\ $tumor_out \\
$normal_args \\ $normal_args \\
$fasta_args \\ $fasta_args \\
$reference_args \\ $reference_args \\
$target_args \\ $target_args \\
--processes $task.cpus \\ --processes $task.cpus \\
$args $args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
}
// somatic_mode bam_input
else if (tumor_bam && normal_bam){
"""
cnvkit.py \\
batch \\
$tumor_out \\
$normal_args \\
$fasta_args \\
$reference_args \\
$target_args \\
--processes $task.cpus \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
}
// tumor_only_mode cram_input
else if(tumor_cram && !normal_exists){
"""
samtools view -T $fasta $fai_reference $tumor -@ $task.cpus -o $tumor_out
cnvkit.py \\
batch \\
$tumor_out \\
$normal_args \\
$fasta_args \\
$reference_args \\
$target_args \\
--processes $task.cpus \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
}
// tumor_only bam_input
else if(tumor_bam && !normal_exists){
"""
cnvkit.py \\
batch \\
$tumor_out \\
$normal_args \\
$fasta_args \\
$reference_args \\
$target_args \\
--processes $task.cpus \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
}
// germline mode cram_input
// normal_args must be --normal []
else if (normal_cram && !tumor_exists){
"""
samtools view -T $fasta $fai_reference $normal -@ $task.cpus -o $tumor_out
cnvkit.py \\
batch \\
$tumor_out \\
$normal_args \\
$fasta_args \\
$reference_args \\
$target_args \\
--processes $task.cpus \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
}
// germline mode bam_input
else if (normal_bam && !tumor_exists){
"""
cnvkit.py \\
batch \\
$tumor_out \\
$normal_args \\
$fasta_args \\
$reference_args \\
$target_args \\
--processes $task.cpus \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
}
cat <<-END_VERSIONS > versions.yml
"${task.process}":
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
} }

View file

@ -29,6 +29,10 @@ input:
type: file type: file
description: | description: |
Input reference genome fasta file (only needed for cram_input and/or when normal_samples are provided) Input reference genome fasta file (only needed for cram_input and/or when normal_samples are provided)
- fasta_fai:
type: file
description: |
Input reference genome fasta index (optional, but recommended for cram_input)
- targetfile: - targetfile:
type: file type: file
description: | description: |

View file

@ -2,13 +2,15 @@ process DEEPTOOLS_BAMCOVERAGE {
tag "$meta.id" tag "$meta.id"
label 'process_low' label 'process_low'
conda (params.enable_conda ? "bioconda::deeptools=3.5.1" : null) conda (params.enable_conda ? "bioconda::deeptools=3.5.1 bioconda::samtools=1.15.1" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/deeptools:3.5.1--py_0': 'https://depot.galaxyproject.org/singularity/mulled-v2-eb9e7907c7a753917c1e4d7a64384c047429618a:2c687053c0252667cca265c9f4118f2c205a604c-0':
'quay.io/biocontainers/deeptools:3.5.1--py_0' }" 'quay.io/biocontainers/mulled-v2-eb9e7907c7a753917c1e4d7a64384c047429618a:2c687053c0252667cca265c9f4118f2c205a604c-0' }"
input: input:
tuple val(meta), path(input), path(input_index) tuple val(meta), path(input), path(input_index)
path(fasta)
path(fasta_fai)
output: output:
tuple val(meta), path("*.bigWig") , emit: bigwig, optional: true tuple val(meta), path("*.bigWig") , emit: bigwig, optional: true
@ -22,16 +24,44 @@ process DEEPTOOLS_BAMCOVERAGE {
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}.bigWig" def prefix = task.ext.prefix ?: "${meta.id}.bigWig"
""" // cram_input is currently not working with deeptools
bamCoverage \\ // therefore it's required to convert cram to bam first
--bam $input \\ def is_cram = input.Extension == "cram" ? true : false
$args \\ def input_out = is_cram ? input.BaseName + ".bam" : "${input}"
--numberOfProcessors ${task.cpus} \\ def fai_reference = fasta_fai ? "--fai-reference ${fasta_fai}" : ""
--outFileName ${prefix}
if (is_cram){
"""
samtools view -T $fasta $input $fai_reference -@ $task.cpus -o $input_out
samtools index -b $input_out -@ $task.cpus
bamCoverage \\
--bam $input_out \\
$args \\
--numberOfProcessors ${task.cpus} \\
--outFileName ${prefix}
cat <<-END_VERSIONS > versions.yml
"${task.process}":
samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
deeptools: \$(bamCoverage --version | sed -e "s/bamCoverage //g")
END_VERSIONS
"""
}
else {
"""
bamCoverage \\
--bam $input_out \\
$args \\
--numberOfProcessors ${task.cpus} \\
--outFileName ${prefix}
cat <<-END_VERSIONS > versions.yml
"${task.process}":
deeptools: \$(bamCoverage --version | sed -e "s/bamCoverage //g")
END_VERSIONS
"""
}
cat <<-END_VERSIONS > versions.yml
"${task.process}":
deeptools: \$(bamCoverage --version | sed -e "s/bamCoverage //g")
END_VERSIONS
"""
} }

View file

@ -25,6 +25,14 @@ input:
type: file type: file
description: BAM/CRAM index file description: BAM/CRAM index file
pattern: "*.{bai,crai}" pattern: "*.{bai,crai}"
- fasta:
type: file
description: Reference file the CRAM file was created with (required with CRAM input)
pattern: "*.{fasta,fa}"
- fasta_fai:
type: file
description: Index of the reference file (optional, but recommended)
pattern: "*.{fai}"
output: output:
- meta: - meta:
@ -47,3 +55,4 @@ output:
authors: authors:
- "@FriederikeHanssen" - "@FriederikeHanssen"
- "@SusiJo"

View file

@ -11,8 +11,8 @@ RUN conda env create -f /environment.yml && conda clean -a
# Setup default ARG variables # Setup default ARG variables
ARG GENOME=GRCh38 ARG GENOME=GRCh38
ARG SPECIES=homo_sapiens ARG SPECIES=homo_sapiens
ARG VEP_VERSION=104 ARG VEP_VERSION=105
ARG VEP_TAG=104.3 ARG VEP_TAG=105.0
# Add conda installation dir to PATH (instead of doing 'conda activate') # Add conda installation dir to PATH (instead of doing 'conda activate')
ENV PATH /opt/conda/envs/nf-core-vep-${VEP_TAG}/bin:$PATH ENV PATH /opt/conda/envs/nf-core-vep-${VEP_TAG}/bin:$PATH

View file

@ -20,9 +20,9 @@ build_push() {
docker push nfcore/vep:${VEP_TAG}.${GENOME} docker push nfcore/vep:${VEP_TAG}.${GENOME}
} }
build_push "GRCh37" "homo_sapiens" "104" "104.3" build_push "GRCh37" "homo_sapiens" "105" "105.0"
build_push "GRCh38" "homo_sapiens" "104" "104.3" build_push "GRCh38" "homo_sapiens" "105" "105.0"
build_push "GRCm38" "mus_musculus" "102" "104.3" build_push "GRCm38" "mus_musculus" "102" "105.0"
build_push "GRCm39" "mus_musculus" "104" "104.3" build_push "GRCm39" "mus_musculus" "105" "105.0"
build_push "CanFam3.1" "canis_lupus_familiaris" "104" "104.3" build_push "CanFam3.1" "canis_lupus_familiaris" "104" "105.0"
build_push "WBcel235" "caenorhabditis_elegans" "104" "104.3" build_push "WBcel235" "caenorhabditis_elegans" "105" "105.0"

View file

@ -1,10 +1,10 @@
# You can use this file to create a conda environment for this module: # You can use this file to create a conda environment for this module:
# conda env create -f environment.yml # conda env create -f environment.yml
name: nf-core-vep-104.3 name: nf-core-vep-105.0
channels: channels:
- conda-forge - conda-forge
- bioconda - bioconda
- defaults - defaults
dependencies: dependencies:
- bioconda::ensembl-vep=104.3 - bioconda::ensembl-vep=105.0

View file

@ -11,7 +11,7 @@ process FILTLONG {
tuple val(meta), path(shortreads), path(longreads) tuple val(meta), path(shortreads), path(longreads)
output: output:
tuple val(meta), path("${meta.id}_lr_filtlong.fastq.gz"), emit: reads tuple val(meta), path("*.fastq.gz"), emit: reads
path "versions.yml" , emit: versions path "versions.yml" , emit: versions
when: when:
@ -20,13 +20,14 @@ process FILTLONG {
script: script:
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}" def prefix = task.ext.prefix ?: "${meta.id}"
def short_reads = meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}" def short_reads = !shortreads ? "" : meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
if ("$longreads" == "${prefix}.fastq.gz") error "Longread FASTQ input and output names are the same, set prefix in module configuration to disambiguate!"
""" """
filtlong \\ filtlong \\
$short_reads \\ $short_reads \\
$args \\ $args \\
$longreads \\ $longreads \\
| gzip -n > ${prefix}_lr_filtlong.fastq.gz | gzip -n > ${prefix}.fastq.gz
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":

View file

@ -0,0 +1,50 @@
process GATK4_CALIBRATEDRAGSTRMODEL {
tag "$meta.id"
label 'process_low'
conda (params.enable_conda ? "bioconda::gatk4=4.2.6.1" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/gatk4:4.2.6.1--hdfd78af_0':
'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
input:
tuple val(meta), path(bam), path(bam_index), path(intervals)
path fasta
path fasta_fai
path dict
path strtablefile
output:
tuple val(meta), path("*.txt") , emit: dragstr_model
path "versions.yml" , emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
def intervals_command = intervals ? "--intervals $intervals" : ""
def avail_mem = 3
if (!task.memory) {
log.info '[GATK CalibrateDragstrModel] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.'
} else {
avail_mem = task.memory.giga
}
"""
gatk --java-options "-Xmx${avail_mem}g" CalibrateDragstrModel \\
--input $bam \\
--output ${prefix}.txt \\
--reference $fasta \\
--str-table-path $strtablefile \\
$intervals_command \\
--tmp-dir . \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
END_VERSIONS
"""
}

View file

@ -0,0 +1,74 @@
name: gatk4_calibratedragstrmodel
description: estimates the parameters for the DRAGstr model
keywords:
- gatk4
- bam
- cram
- sam
- calibratedragstrmodel
tools:
- gatk4:
description:
Genome Analysis Toolkit (GATK4). Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools
with a primary focus on variant discovery and genotyping. Its powerful processing engine
and high-performance computing features make it capable of taking on projects of any size.
homepage: https://gatk.broadinstitute.org/hc/en-us
documentation: https://gatk.broadinstitute.org/hc/en-us/articles/360057441571-CalibrateDragstrModel-BETA-
tool_dev_url: https://github.com/broadinstitute/gatk
doi: 10.1158/1538-7445.AM2017-3590
licence: ["Apache-2.0"]
input:
# Only when we have meta
- meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- bam:
type: file
description: BAM/CRAM/SAM file
pattern: "*.{bam,cram,sam}"
- bam_index:
type: file
description: index of the BAM/CRAM/SAM file
pattern: "*.{bai,crai,sai}"
- intervals:
type: file
description: BED file or interval list containing regions (optional)
pattern: "*.{bed,interval_list}"
- fasta:
type: file
description: The reference FASTA file
pattern: "*.{fasta,fa}"
- fasta_fai:
type: file
description: The index of the reference FASTA file
pattern: "*.fai"
- dict:
type: file
description: The sequence dictionary of the reference FASTA file
pattern: "*.dict"
- strtablefile:
type: file
description: The StrTableFile zip folder of the reference FASTA file
pattern: "*.zip"
output:
#Only when we have meta
- meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
- dragstr_model:
type: file
description: The DragSTR model
pattern: "*.txt"
authors:
- "@nvnieuwk"

View file

@ -0,0 +1,53 @@
process GATK4_COMPOSESTRTABLEFILE {
tag "$fasta"
label 'process_low'
conda (params.enable_conda ? "bioconda::gatk4=4.2.6.1" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/gatk4:4.2.6.1--hdfd78af_0':
'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
input:
path(fasta)
path(fasta_fai)
path(dict)
output:
path "*.zip" , emit: str_table
path "versions.yml" , emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def avail_mem = 6
if (!task.memory) {
log.info '[GATK ComposeSTRTableFile] Available memory not known - defaulting to 6GB. Specify process memory requirements to change this.'
} else {
avail_mem = task.memory.giga
}
"""
gatk --java-options "-Xmx${avail_mem}g" ComposeSTRTableFile \\
--reference $fasta \\
--output ${fasta.baseName}.zip \\
--tmp-dir . \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
END_VERSIONS
"""
stub:
"""
touch test.zip
cat <<-END_VERSIONS > versions.yml
"${task.process}":
gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
END_VERSIONS
"""
}

View file

@ -0,0 +1,43 @@
name: "gatk4_composestrtablefile"
description: This tool looks for low-complexity STR sequences along the reference that are later used to estimate the Dragstr model during single sample auto calibration CalibrateDragstrModel.
keywords:
- gatk4
- composestrtablefile
tools:
- gatk4:
description:
Genome Analysis Toolkit (GATK4). Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools
with a primary focus on variant discovery and genotyping. Its powerful processing engine
and high-performance computing features make it capable of taking on projects of any size.
homepage: https://gatk.broadinstitute.org/hc/en-us
documentation: https://gatk.broadinstitute.org/hc/en-us/articles/4405451249819-ComposeSTRTableFile
tool_dev_url: https://github.com/broadinstitute/gatk
doi: 10.1158/1538-7445.AM2017-3590
licence: ["Apache-2.0"]
input:
- fasta:
type: file
description: FASTA reference file
pattern: "*.{fasta,fa}"
- fasta_fai:
type: file
description: index of the FASTA reference file
pattern: "*.fai"
- dict:
type: file
description: Sequence dictionary of the FASTA reference file
pattern: "*.dict"
output:
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
- str_table:
type: file
description: A zipped folder containing the STR table files
pattern: "*.zip"
authors:
- "@nvnieuwk"

View file

@ -8,7 +8,7 @@ process GATK4_HAPLOTYPECALLER {
'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }" 'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
input: input:
tuple val(meta), path(input), path(input_index), path(intervals) tuple val(meta), path(input), path(input_index), path(intervals), path(dragstr_model)
path fasta path fasta
path fai path fai
path dict path dict
@ -28,6 +28,7 @@ process GATK4_HAPLOTYPECALLER {
def prefix = task.ext.prefix ?: "${meta.id}" def prefix = task.ext.prefix ?: "${meta.id}"
def dbsnp_command = dbsnp ? "--dbsnp $dbsnp" : "" def dbsnp_command = dbsnp ? "--dbsnp $dbsnp" : ""
def interval_command = intervals ? "--intervals $intervals" : "" def interval_command = intervals ? "--intervals $intervals" : ""
def dragstr_command = dragstr_model ? "--dragstr-params-path $dragstr_model" : ""
def avail_mem = 3 def avail_mem = 3
if (!task.memory) { if (!task.memory) {
@ -42,6 +43,7 @@ process GATK4_HAPLOTYPECALLER {
--reference $fasta \\ --reference $fasta \\
$dbsnp_command \\ $dbsnp_command \\
$interval_command \\ $interval_command \\
$dragstr_command \\
--tmp-dir . \\ --tmp-dir . \\
$args $args

View file

@ -32,6 +32,10 @@ input:
- intervals: - intervals:
type: file type: file
description: Bed file with the genomic regions included in the library (optional) description: Bed file with the genomic regions included in the library (optional)
- dragstr_model:
type: file
description: Text file containing the DragSTR model of the used BAM/CRAM file (optional)
pattern: "*.txt"
- fasta: - fasta:
type: file type: file
description: The reference fasta file description: The reference fasta file

View file

@ -13,6 +13,7 @@ process GATK4_MERGEVCFS {
output: output:
tuple val(meta), path('*.vcf.gz'), emit: vcf tuple val(meta), path('*.vcf.gz'), emit: vcf
tuple val(meta), path("*.tbi") , emit: tbi
path "versions.yml" , emit: versions path "versions.yml" , emit: versions
when: when:

View file

@ -35,6 +35,11 @@ output:
type: file type: file
description: merged vcf file description: merged vcf file
pattern: "*.vcf.gz" pattern: "*.vcf.gz"
- tbi:
type: file
description: index files for the merged vcf files
pattern: "*.tbi"
- versions: - versions:
type: file type: file
description: File containing software versions description: File containing software versions

View file

@ -2,10 +2,10 @@ process PICARD_ADDORREPLACEREADGROUPS {
tag "$meta.id" tag "$meta.id"
label 'process_low' label 'process_low'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_CLEANSAM {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_COLLECTHSMETRICS {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_COLLECTMULTIPLEMETRICS {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_COLLECTWGSMETRICS {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_CREATESEQUENCEDICTIONARY {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(fasta) tuple val(meta), path(fasta)

View file

@ -2,10 +2,10 @@ process PICARD_CROSSCHECKFINGERPRINTS {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(input1) tuple val(meta), path(input1)

View file

@ -2,10 +2,10 @@ process PICARD_FILTERSAMREADS {
tag "$meta.id" tag "$meta.id"
label 'process_low' label 'process_low'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam), path(readlist) tuple val(meta), path(bam), path(readlist)

View file

@ -2,10 +2,10 @@ process PICARD_FIXMATEINFORMATION {
tag "$meta.id" tag "$meta.id"
label 'process_low' label 'process_low'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_LIFTOVERVCF {
tag "$meta.id" tag "$meta.id"
label 'process_low' label 'process_low'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(input_vcf) tuple val(meta), path(input_vcf)

View file

@ -2,10 +2,10 @@ process PICARD_MARKDUPLICATES {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_MERGESAMFILES {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bams) tuple val(meta), path(bams)

View file

@ -2,10 +2,10 @@ process PICARD_SORTSAM {
tag "$meta.id" tag "$meta.id"
label 'process_low' label 'process_low'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(bam) tuple val(meta), path(bam)

View file

@ -2,10 +2,10 @@ process PICARD_SORTVCF {
tag "$meta.id" tag "$meta.id"
label 'process_medium' label 'process_medium'
conda (params.enable_conda ? "bioconda::picard=2.27.1" : null) conda (params.enable_conda ? "bioconda::picard=2.27.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/picard:2.27.1--hdfd78af_0' : 'https://depot.galaxyproject.org/singularity/picard:2.27.2--hdfd78af_0' :
'quay.io/biocontainers/picard:2.27.1--hdfd78af_0' }" 'quay.io/biocontainers/picard:2.27.2--hdfd78af_0' }"
input: input:
tuple val(meta), path(vcf) tuple val(meta), path(vcf)

View file

@ -2,16 +2,15 @@ process STAR_ALIGN {
tag "$meta.id" tag "$meta.id"
label 'process_high' label 'process_high'
// Note: 2.7X indices incompatible with AWS iGenomes. conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
conda (params.enable_conda ? 'bioconda::star=2.7.9a' : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/star:2.7.9a--h9ee0642_0' : 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
'quay.io/biocontainers/star:2.7.9a--h9ee0642_0' }" 'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
input: input:
tuple val(meta), path(reads) tuple val(meta), path(reads)
path index path index
path gtf path gtf
val star_ignore_sjdbgtf val star_ignore_sjdbgtf
val seq_platform val seq_platform
val seq_center val seq_center
@ -67,6 +66,8 @@ process STAR_ALIGN {
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":
star: \$(STAR --version | sed -e "s/STAR_//g") star: \$(STAR --version | sed -e "s/STAR_//g")
samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
END_VERSIONS END_VERSIONS
""" """
} }

View file

@ -2,19 +2,18 @@ process STAR_GENOMEGENERATE {
tag "$fasta" tag "$fasta"
label 'process_high' label 'process_high'
// Note: 2.7X indices incompatible with AWS iGenomes. conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
conda (params.enable_conda ? "bioconda::star=2.7.9a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' : 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' }" 'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
input: input:
path fasta path fasta
path gtf path gtf
output: output:
path "star" , emit: index path "star" , emit: index
path "versions.yml" , emit: versions path "versions.yml", emit: versions
when: when:
task.ext.when == null || task.ext.when task.ext.when == null || task.ext.when
@ -22,7 +21,7 @@ process STAR_GENOMEGENERATE {
script: script:
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def args_list = args.tokenize() def args_list = args.tokenize()
def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : '' def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
if (args_list.contains('--genomeSAindexNbases')) { if (args_list.contains('--genomeSAindexNbases')) {
""" """
mkdir star mkdir star

View file

@ -21,12 +21,18 @@ process UNTAR {
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def args2 = task.ext.args2 ?: '' def args2 = task.ext.args2 ?: ''
untar = archive.toString() - '.tar.gz' untar = archive.toString() - '.tar.gz'
""" """
mkdir output
tar \\ tar \\
-C output --strip-components 1 \\
-xzvf \\ -xzvf \\
$args \\ $args \\
$archive \\ $archive \\
$args2 \\ $args2
mv output ${untar}
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":

View file

@ -0,0 +1,67 @@
process VSEARCH_USEARCHGLOBAL {
tag "${meta.id}"
label 'process_low'
conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
input:
tuple val(meta), path(queryfasta)
path db
val idcutoff
val outoption
val user_columns
output:
tuple val(meta), path('*.aln') , optional: true, emit: aln
tuple val(meta), path('*.biom') , optional: true, emit: biom
tuple val(meta), path('*.lca') , optional: true, emit: lca
tuple val(meta), path('*.mothur') , optional: true, emit: mothur
tuple val(meta), path('*.otu') , optional: true, emit: otu
tuple val(meta), path('*.sam') , optional: true, emit: sam
tuple val(meta), path('*.tsv') , optional: true, emit: tsv
tuple val(meta), path('*.txt') , optional: true, emit: txt
tuple val(meta), path('*.uc') , optional: true, emit: uc
path "versions.yml" , emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
def columns = user_columns ? "--userfields ${user_columns}" : ''
switch ( outoption ) {
case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
case "samout": outfmt = "--samout"; out_ext = 'sam'; break
case "uc": outfmt = "--uc"; out_ext = 'uc'; break
case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
default:
outfmt = "--alnout";
out_ext = 'aln';
log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
break
}
"""
vsearch \\
--usearch_global $queryfasta \\
--db $db \\
--id $idcutoff \\
--threads $task.cpus \\
$args \\
${columns} \\
${outfmt} ${prefix}.${out_ext}
cat <<-END_VERSIONS > versions.yml
"${task.process}":
vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
END_VERSIONS
"""
}

View file

@ -0,0 +1,83 @@
name: "vsearch_usearchglobal"
description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
keywords:
- vsearch
- usearch
- alignment
- fasta
tools:
- "vsearch":
description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
homepage: "https://github.com/torognes/vsearch"
documentation: "None"
tool_dev_url: "https://github.com/torognes/vsearch"
doi: "doi: 10.7717/peerj.2584"
licence: "['GPL v3-or-later OR BSD-2-clause']"
input:
- meta:
type: map
description: Groovy Map containing sample information e.g. [ id:'test' ]
- queryfasta:
type: file
description: Query sequences in FASTA format
pattern: "*.{fasta,fa,fna,faa}"
- db:
type: file
description: Reference database file in FASTA or UDB format
pattern: "*"
- idcutoff:
type: real
description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
- outoption:
type: string
description: Specify the type of output file to be generated by selecting one of the vsearch output file options
pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
- user_columns:
type: string
description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
output:
- aln:
type: file
description: Results in pairwise alignment format
pattern: "*.{aln}"
- biom:
type: file
description: Results in an OTU table in the biom version 1.0 file format
pattern: "*.{biom}"
- lca:
type: file
description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
pattern: "*.{lca}"
- mothur:
type: file
description: Results in an OTU table in the mothur shared tab-separated plain text file format
pattern: "*.{mothur}"
- otu:
type: file
description: Results in an OTU table in the classic tab-separated plain text format
pattern: "*.{otu}"
- sam:
type: file
description: Results written in sam format
pattern: "*.{sam}"
- tsv:
type: file
description: Results in tab-separated output, columns defined by user
pattern: "*.{tsv}"
- txt:
type: file
description: Tab delimited results in blast-like tabular format
pattern: "*.{txt}"
- uc:
type: file
description: Tab delimited results in a uclust-like format with 10 columns
pattern: "*.{uc}"
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
authors:
- "@jtangrot"

View file

@ -743,6 +743,10 @@ gatk4/calculatecontamination:
- modules/gatk4/calculatecontamination/** - modules/gatk4/calculatecontamination/**
- tests/modules/gatk4/calculatecontamination/** - tests/modules/gatk4/calculatecontamination/**
gatk4/calibratedragstrmodel:
- modules/gatk4/calibratedragstrmodel/**
- tests/modules/gatk4/calibratedragstrmodel/**
gatk4/cnnscorevariants: gatk4/cnnscorevariants:
- modules/gatk4/cnnscorevariants/** - modules/gatk4/cnnscorevariants/**
- tests/modules/gatk4/cnnscorevariants/** - tests/modules/gatk4/cnnscorevariants/**
@ -751,6 +755,10 @@ gatk4/combinegvcfs:
- modules/gatk4/combinegvcfs/** - modules/gatk4/combinegvcfs/**
- tests/modules/gatk4/combinegvcfs/** - tests/modules/gatk4/combinegvcfs/**
gatk4/composestrtablefile:
- modules/gatk4/composestrtablefile/**
- tests/modules/gatk4/composestrtablefile/**
gatk4/createsequencedictionary: gatk4/createsequencedictionary:
- modules/gatk4/createsequencedictionary/** - modules/gatk4/createsequencedictionary/**
- tests/modules/gatk4/createsequencedictionary/** - tests/modules/gatk4/createsequencedictionary/**
@ -2056,6 +2064,10 @@ vcftools:
- modules/vcftools/** - modules/vcftools/**
- tests/modules/vcftools/** - tests/modules/vcftools/**
vsearch/usearchglobal:
- modules/vsearch/usearchglobal/**
- tests/modules/vsearch/usearchglobal/**
yara/index: yara/index:
- modules/yara/index/** - modules/yara/index/**
- tests/modules/yara/index/** - tests/modules/yara/index/**

View file

@ -23,6 +23,8 @@ params {
test_bed12 = "${test_data_dir}/genomics/sarscov2/genome/bed/test.bed12" test_bed12 = "${test_data_dir}/genomics/sarscov2/genome/bed/test.bed12"
baits_bed = "${test_data_dir}/genomics/sarscov2/genome/bed/baits.bed" baits_bed = "${test_data_dir}/genomics/sarscov2/genome/bed/baits.bed"
reference_cnn = "${test_data_dir}/genomics/sarscov2/genome/cnn/reference.cnn"
kraken2 = "${test_data_dir}/genomics/sarscov2/genome/db/kraken2" kraken2 = "${test_data_dir}/genomics/sarscov2/genome/db/kraken2"
kraken2_tar_gz = "${test_data_dir}/genomics/sarscov2/genome/db/kraken2.tar.gz" kraken2_tar_gz = "${test_data_dir}/genomics/sarscov2/genome/db/kraken2.tar.gz"
@ -121,6 +123,7 @@ params {
genome_elfasta = "${test_data_dir}/genomics/homo_sapiens/genome/genome.elfasta" genome_elfasta = "${test_data_dir}/genomics/homo_sapiens/genome/genome.elfasta"
genome_fasta = "${test_data_dir}/genomics/homo_sapiens/genome/genome.fasta" genome_fasta = "${test_data_dir}/genomics/homo_sapiens/genome/genome.fasta"
genome_fasta_fai = "${test_data_dir}/genomics/homo_sapiens/genome/genome.fasta.fai" genome_fasta_fai = "${test_data_dir}/genomics/homo_sapiens/genome/genome.fasta.fai"
genome_strtablefile = "${test_data_dir}/genomics/homo_sapiens/genome/genome_strtablefile.zip"
genome_dict = "${test_data_dir}/genomics/homo_sapiens/genome/genome.dict" genome_dict = "${test_data_dir}/genomics/homo_sapiens/genome/genome.dict"
genome_gff3 = "${test_data_dir}/genomics/homo_sapiens/genome/genome.gff3" genome_gff3 = "${test_data_dir}/genomics/homo_sapiens/genome/genome.gff3"
genome_gtf = "${test_data_dir}/genomics/homo_sapiens/genome/genome.gtf" genome_gtf = "${test_data_dir}/genomics/homo_sapiens/genome/genome.gtf"
@ -146,6 +149,7 @@ params {
genome_21_multi_interval_bed_gz = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz" genome_21_multi_interval_bed_gz = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz"
genome_21_multi_interval_bed_gz_tbi = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi" genome_21_multi_interval_bed_gz_tbi = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi"
genome_21_chromosomes_dir = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz" genome_21_chromosomes_dir = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz"
genome_21_reference_cnn = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/reference_chr21.cnn"
dbsnp_146_hg38_elsites = "${test_data_dir}/genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.elsites" dbsnp_146_hg38_elsites = "${test_data_dir}/genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.elsites"
dbsnp_146_hg38_vcf_gz = "${test_data_dir}/genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz" dbsnp_146_hg38_vcf_gz = "${test_data_dir}/genomics/homo_sapiens/genome/vcf/dbsnp_146.hg38.vcf.gz"
@ -262,6 +266,8 @@ params {
test_pileups_table = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test.pileups.table" test_pileups_table = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test.pileups.table"
test2_pileups_table = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test2.pileups.table" test2_pileups_table = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test2.pileups.table"
test_paired_end_sorted_dragstrmodel = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_paired_end_sorted_dragstrmodel.txt"
test_genomicsdb_tar_gz = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_genomicsdb.tar.gz" test_genomicsdb_tar_gz = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_genomicsdb.tar.gz"
test_pon_genomicsdb_tar_gz = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_pon_genomicsdb.tar.gz" test_pon_genomicsdb_tar_gz = "${test_data_dir}/genomics/homo_sapiens/illumina/gatk/test_pon_genomicsdb.tar.gz"
@ -323,6 +329,8 @@ params {
test_sv_vcf = "${test_data_dir}/genomics/homo_sapiens/illumina/vcf/sv_query.vcf.gz" test_sv_vcf = "${test_data_dir}/genomics/homo_sapiens/illumina/vcf/sv_query.vcf.gz"
test_pytor = "${test_data_dir}/genomics/homo_sapiens/illumina/pytor/test.pytor" test_pytor = "${test_data_dir}/genomics/homo_sapiens/illumina/pytor/test.pytor"
test_flowcell = "${test_data_dir}/genomics/homo_sapiens/illumina/bcl/flowcell.tar.gz"
} }
'pacbio' { 'pacbio' {
primers = "${test_data_dir}/genomics/homo_sapiens/pacbio/fasta/primers.fasta" primers = "${test_data_dir}/genomics/homo_sapiens/pacbio/fasta/primers.fasta"
@ -415,9 +423,6 @@ params {
'txt' { 'txt' {
hello = "${test_data_dir}/generic/txt/hello.txt" hello = "${test_data_dir}/generic/txt/hello.txt"
} }
'cnn' {
reference = "${test_data_dir}/generic/cnn/reference.cnn"
}
'cooler'{ 'cooler'{
test_pairix_pair_gz = "${test_data_dir}/genomics/homo_sapiens/cooler/cload/hg19/hg19.GM12878-MboI.pairs.subsample.blksrt.txt.gz" test_pairix_pair_gz = "${test_data_dir}/genomics/homo_sapiens/cooler/cload/hg19/hg19.GM12878-MboI.pairs.subsample.blksrt.txt.gz"
test_pairix_pair_gz_px2 = "${test_data_dir}/genomics/homo_sapiens/cooler/cload/hg19/hg19.GM12878-MboI.pairs.subsample.blksrt.txt.gz.px2" test_pairix_pair_gz_px2 = "${test_data_dir}/genomics/homo_sapiens/cooler/cload/hg19/hg19.GM12878-MboI.pairs.subsample.blksrt.txt.gz.px2"

View file

@ -4,13 +4,25 @@ nextflow.enable.dsl = 2
include { BCFTOOLS_CONCAT } from '../../../../modules/bcftools/concat/main.nf' include { BCFTOOLS_CONCAT } from '../../../../modules/bcftools/concat/main.nf'
workflow test_bcftools_concat { workflow test_bcftools_concat_tbi {
input = [ [ id:'test3' ], // meta map input = [ [ id:'test3' ], // meta map
[ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true), [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ] file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
[ file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test2_vcf_gz_tbi'], checkIfExists: true) ]
]
BCFTOOLS_CONCAT ( input )
}
workflow test_bcftools_concat_no_tbi {
input = [ [ id:'test3' ], // meta map
[ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
[]
] ]
BCFTOOLS_CONCAT ( input ) BCFTOOLS_CONCAT ( input )
} }

View file

@ -1,8 +1,17 @@
- name: bcftools concat test_bcftools_concat - name: bcftools concat test_bcftools_concat_tbi
command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_tbi -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config
tags: tags:
- bcftools/concat
- bcftools - bcftools
- bcftools/concat
files:
- path: output/bcftools/test3.vcf.gz
md5sum: 35c88bfaad20101062e98beb217d7137
- name: bcftools concat test_bcftools_concat_no_tbi
command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_no_tbi -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config
tags:
- bcftools
- bcftools/concat
files: files:
- path: output/bcftools/test3.vcf.gz - path: output/bcftools/test3.vcf.gz
md5sum: 35c88bfaad20101062e98beb217d7137 md5sum: 35c88bfaad20101062e98beb217d7137

View file

@ -5,8 +5,9 @@ nextflow.enable.dsl = 2
include { CNVKIT_BATCH as CNVKIT_HYBRID } from '../../../../modules/cnvkit/batch/main.nf' include { CNVKIT_BATCH as CNVKIT_HYBRID } from '../../../../modules/cnvkit/batch/main.nf'
include { CNVKIT_BATCH as CNVKIT_WGS } from '../../../../modules/cnvkit/batch/main.nf' include { CNVKIT_BATCH as CNVKIT_WGS } from '../../../../modules/cnvkit/batch/main.nf'
include { CNVKIT_BATCH as CNVKIT_TUMORONLY } from '../../../../modules/cnvkit/batch/main.nf' include { CNVKIT_BATCH as CNVKIT_TUMORONLY } from '../../../../modules/cnvkit/batch/main.nf'
include { CNVKIT_BATCH as CNVKIT_GERMLINE } from '../../../../modules/cnvkit/batch/main.nf'
workflow test_cnvkit_hybrid { workflow test_cnvkit_hybrid_somatic {
input = [ input = [
[ id:'test' ], // meta map [ id:'test' ], // meta map
@ -16,10 +17,10 @@ workflow test_cnvkit_hybrid {
fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
targets = file(params.test_data['sarscov2']['genome']['baits_bed'], checkIfExists: true) targets = file(params.test_data['sarscov2']['genome']['baits_bed'], checkIfExists: true)
CNVKIT_HYBRID ( input, fasta, targets, [] ) CNVKIT_HYBRID ( input, fasta, [], targets, [] )
} }
workflow test_cnvkit_wgs { workflow test_cnvkit_wgs_somatic {
input = [ input = [
[ id:'test'], // meta map [ id:'test'], // meta map
@ -28,42 +29,71 @@ workflow test_cnvkit_wgs {
] ]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
CNVKIT_WGS ( input, fasta, [], [] ) CNVKIT_WGS ( input, fasta, [], [], [] )
} }
workflow test_cnvkit_cram { workflow test_cnvkit_cram_wgs_somatic {
input = [ input = [
[ id:'test'], // meta map [ id:'test'], // meta map
file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true)
] ]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
CNVKIT_WGS ( input, fasta, [], [] ) CNVKIT_WGS ( input, fasta, fasta_fai, [], [] )
} }
workflow test_cnvkit_tumoronly {
workflow test_cnvkit_tumoronly_hybrid_bam {
input = [ input = [
[ id:'test'], // meta map [ id:'test'], // meta map
file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_bam'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_bam'], checkIfExists: true),
[] []
] ]
reference = file(params.test_data['generic']['cnn']['reference'], checkIfExists: true) reference = file(params.test_data['homo_sapiens']['genome']['genome_21_reference_cnn'], checkIfExists: true)
CNVKIT_TUMORONLY ( input, [], [], reference ) CNVKIT_TUMORONLY ( input, [], [], [], reference )
} }
workflow test_cnvkit_tumoronly_cram { workflow test_cnvkit_tumoronly_hybrid_cram {
input = [ input = [
[ id:'test'], // meta map [ id:'test'], // meta map
file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_cram'], checkIfExists: true),
[] []
] ]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
reference = file(params.test_data['generic']['cnn']['reference'], checkIfExists: true) reference = file(params.test_data['homo_sapiens']['genome']['genome_21_reference_cnn'], checkIfExists: true)
CNVKIT_TUMORONLY ( input, fasta, [], reference ) CNVKIT_TUMORONLY ( input, fasta, [], [], reference )
}
workflow test_cnvkit_germline_hybrid_cram {
input = [
[ id:'test'], // meta map
[],
file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_cram'], checkIfExists: true)
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta_fai'], checkIfExists: true)
targets = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_bed'], checkIfExists: true)
CNVKIT_GERMLINE ( input, fasta, fasta_fai, targets, [])
}
workflow test_cnvkit_germline_hybrid_bam {
input = [
[ id:'test'], // meta map
[],
file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_recalibrated_sorted_bam'], checkIfExists: true)
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true)
targets = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_bed'], checkIfExists: true)
CNVKIT_GERMLINE ( input, fasta, [], targets, [])
} }

View file

@ -1,5 +1,5 @@
- name: cnvkit batch test_cnvkit_hybrid - name: cnvkit batch test_cnvkit_hybrid_somatic
command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_hybrid -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_hybrid_somatic -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config
tags: tags:
- cnvkit - cnvkit
- cnvkit/batch - cnvkit/batch
@ -26,8 +26,8 @@
- path: output/cnvkit/test.single_end.sorted.targetcoverage.cnn - path: output/cnvkit/test.single_end.sorted.targetcoverage.cnn
md5sum: aa8a018b1d4d1e688c9f9f6ae01bf4d7 md5sum: aa8a018b1d4d1e688c9f9f6ae01bf4d7
- name: cnvkit batch test_cnvkit_wgs - name: cnvkit batch test_cnvkit_wgs_somatic
command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_wgs -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_wgs_somatic -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config
tags: tags:
- cnvkit - cnvkit
- cnvkit/batch - cnvkit/batch
@ -56,8 +56,8 @@
- path: output/cnvkit/test2.paired_end.sorted.targetcoverage.cnn - path: output/cnvkit/test2.paired_end.sorted.targetcoverage.cnn
md5sum: 6ae6b3fce7299eedca6133d911c38fe1 md5sum: 6ae6b3fce7299eedca6133d911c38fe1
- name: cnvkit batch test_cnvkit_cram - name: cnvkit batch test_cnvkit_cram_wgs_somatic
command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_cram -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_cram_wgs_somatic -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config
tags: tags:
- cnvkit - cnvkit
- cnvkit/batch - cnvkit/batch
@ -86,22 +86,98 @@
- path: output/cnvkit/test2.paired_end.sorted.targetcoverage.cnn - path: output/cnvkit/test2.paired_end.sorted.targetcoverage.cnn
md5sum: 6ae6b3fce7299eedca6133d911c38fe1 md5sum: 6ae6b3fce7299eedca6133d911c38fe1
- name: cnvkit batch test_cnvkit_tumoronly - name: cnvkit batch test_cnvkit_tumoronly_hybrid_bam
command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly_hybrid_bam -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config
tags: tags:
- cnvkit - cnvkit
- cnvkit/batch - cnvkit/batch
files: files:
- path: output/cnvkit/reference.antitarget-tmp.bed - path: output/cnvkit/reference_chr21.antitarget-tmp.bed
- path: output/cnvkit/reference.target-tmp.bed md5sum: 3d4d20f9f23b39970865d29ef239d20b
md5sum: 26d25ff2d6c45b6d92169b3559c6acdb - path: output/cnvkit/reference_chr21.target-tmp.bed
md5sum: 657b25dbda8516624efa8cb2cf3716ca
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
md5sum: 067115082c4af4b64d58c0dc3a3642e4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
md5sum: f6adc75a0a86b7a921eca1b79a394cb0
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
md5sum: f7caeca04aba28b125ce26b511f42afb
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
md5sum: d9bdb71ce807051369577ee7f807a40c
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
md5sum: 2b56aac606ba6183d018b30ca58afcec
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
md5sum: e6d0190c1c37ce6e41f76ca5b24ccca3
- name: cnvkit batch test_cnvkit_tumoronly_cram - name: cnvkit batch test_cnvkit_tumoronly_hybrid_cram
command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly_cram -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_tumoronly_hybrid_cram -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config
tags: tags:
- cnvkit - cnvkit
- cnvkit/batch - cnvkit/batch
files: files:
- path: output/cnvkit/reference.antitarget-tmp.bed - path: output/cnvkit/reference_chr21.antitarget-tmp.bed
- path: output/cnvkit/reference.target-tmp.bed md5sum: 3d4d20f9f23b39970865d29ef239d20b
md5sum: 26d25ff2d6c45b6d92169b3559c6acdb - path: output/cnvkit/reference_chr21.target-tmp.bed
md5sum: 657b25dbda8516624efa8cb2cf3716ca
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
md5sum: 067115082c4af4b64d58c0dc3a3642e4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
md5sum: f6adc75a0a86b7a921eca1b79a394cb0
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
md5sum: f7caeca04aba28b125ce26b511f42afb
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
md5sum: d9bdb71ce807051369577ee7f807a40c
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
md5sum: 2b56aac606ba6183d018b30ca58afcec
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
md5sum: e6d0190c1c37ce6e41f76ca5b24ccca3
- name: cnvkit batch test_cnvkit_germline_hybrid_cram
command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_germline_hybrid_cram -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config
tags:
- cnvkit
- cnvkit/batch
files:
- path: output/cnvkit/multi_intervals.antitarget.bed
md5sum: 3d4d20f9f23b39970865d29ef239d20b
- path: output/cnvkit/multi_intervals.target.bed
md5sum: 86d30493bb2e619a93f4ebc2923d29f3
- path: output/cnvkit/reference.cnn
md5sum: a09ee4be5dda1cf0f68073bdb3aad8ec
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
md5sum: 067115082c4af4b64d58c0dc3a3642e4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
md5sum: 68b62b75cd91b2ffe5633686fb943490
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
md5sum: df196edd72613c59186f4d87df3dc4a4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
md5sum: 3b4fc0cc73be78f978cfe2422470753e
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
md5sum: 4e67451dbcb6601fc3fa5dd7e570f1d4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
md5sum: b4a49faf170e436ec32dcc21ccc3ce8f
- name: cnvkit batch test_cnvkit_germline_hybrid_bam
command: nextflow run ./tests/modules/cnvkit/batch -entry test_cnvkit_germline_hybrid_bam -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/batch/nextflow.config
tags:
- cnvkit
- cnvkit/batch
files:
- path: output/cnvkit/multi_intervals.antitarget.bed
md5sum: 3d4d20f9f23b39970865d29ef239d20b
- path: output/cnvkit/multi_intervals.target.bed
md5sum: 86d30493bb2e619a93f4ebc2923d29f3
- path: output/cnvkit/reference.cnn
md5sum: a09ee4be5dda1cf0f68073bdb3aad8ec
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.antitargetcoverage.cnn
md5sum: 067115082c4af4b64d58c0dc3a3642e4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.bintest.cns
md5sum: 68b62b75cd91b2ffe5633686fb943490
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.call.cns
md5sum: df196edd72613c59186f4d87df3dc4a4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cnr
md5sum: 3b4fc0cc73be78f978cfe2422470753e
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.cns
md5sum: 4e67451dbcb6601fc3fa5dd7e570f1d4
- path: output/cnvkit/test2.paired_end.recalibrated.sorted.targetcoverage.cnn
md5sum: b4a49faf170e436ec32dcc21ccc3ce8f

View file

@ -12,7 +12,7 @@ workflow test_deeptools_bamcoverage_bam {
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
] ]
DEEPTOOLS_BAMCOVERAGE ( input ) DEEPTOOLS_BAMCOVERAGE ( input, [], [] )
} }
workflow test_deeptools_bamcoverage_cram { workflow test_deeptools_bamcoverage_cram {
@ -22,6 +22,20 @@ workflow test_deeptools_bamcoverage_cram {
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
] ]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
DEEPTOOLS_BAMCOVERAGE ( input ) DEEPTOOLS_BAMCOVERAGE ( input, fasta, fasta_fai)
}
workflow test_deeptools_bamcoverage_cram_no_fasta_fai {
input = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
DEEPTOOLS_BAMCOVERAGE ( input, fasta, [])
} }

View file

@ -1,21 +1,26 @@
- name: deeptools bamcoverage test_deeptools_bamcoverage_bam - name: deeptools bamcoverage test_deeptools_bamcoverage_bam
command: nextflow run tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_bam -c tests/config/nextflow.config command: nextflow run ./tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_bam -c ./tests/config/nextflow.config -c ./tests/modules/deeptools/bamcoverage/nextflow.config
tags: tags:
- deeptools
- deeptools/bamcoverage - deeptools/bamcoverage
- deeptools
files: files:
- path: output/deeptools/test.bigWig - path: output/deeptools/test.bigWig
md5sum: 95fe9383a9e6c02aea6b785cf074274f md5sum: 95fe9383a9e6c02aea6b785cf074274f
- path: output/deeptools/versions.yml
md5sum: 68c94e73b7a8c0935578bad61fea54c1
- name: deeptools bamcoverage test_deeptools_bamcoverage_cram - name: deeptools bamcoverage test_deeptools_bamcoverage_cram
command: nextflow run tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_cram -c tests/config/nextflow.config command: nextflow run ./tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_cram -c ./tests/config/nextflow.config -c ./tests/modules/deeptools/bamcoverage/nextflow.config
tags: tags:
- deeptools
- deeptools/bamcoverage - deeptools/bamcoverage
- deeptools
files:
- path: output/deeptools/test.bigWig
md5sum: 95fe9383a9e6c02aea6b785cf074274f
- name: deeptools bamcoverage test_deeptools_bamcoverage_cram_no_fasta_fai
command: nextflow run ./tests/modules/deeptools/bamcoverage -entry test_deeptools_bamcoverage_cram_no_fasta_fai -c ./tests/config/nextflow.config -c ./tests/modules/deeptools/bamcoverage/nextflow.config
tags:
- deeptools/bamcoverage
- deeptools
files: files:
- path: output/deeptools/test.bigWig - path: output/deeptools/test.bigWig
md5sum: 95fe9383a9e6c02aea6b785cf074274f md5sum: 95fe9383a9e6c02aea6b785cf074274f
- path: output/deeptools/versions.yml
md5sum: 665bbd2979c49bf3974a24bd44a88e94

View file

@ -2,4 +2,7 @@ process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
ext.args = "--min_length 10"
ext.prefix = "test_lr"
} }

View file

@ -1,23 +1,26 @@
- name: filtlong test_filtlong - name: filtlong test_filtlong
command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
tags: tags:
- filtlong - filtlong
files: files:
- path: output/filtlong/test_lr_filtlong.fastq.gz - path: output/filtlong/test_lr.fastq.gz
md5sum: 7029066c27ac6f5ef18d660d5741979a contains:
- "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
- name: filtlong test_filtlong_illumina_se - name: filtlong test_filtlong_illumina_se
command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
tags: tags:
- filtlong - filtlong
files: files:
- path: output/filtlong/test_lr_filtlong.fastq.gz - path: output/filtlong/test_lr.fastq.gz
md5sum: 7029066c27ac6f5ef18d660d5741979a contains:
- "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
- name: filtlong test_filtlong_illumina_pe - name: filtlong test_filtlong_illumina_pe
command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
tags: tags:
- filtlong - filtlong
files: files:
- path: output/filtlong/test_lr_filtlong.fastq.gz - path: output/filtlong/test_lr.fastq.gz
md5sum: 7029066c27ac6f5ef18d660d5741979a contains:
- "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"

View file

@ -0,0 +1,66 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { GATK4_CALIBRATEDRAGSTRMODEL } from '../../../../modules/gatk4/calibratedragstrmodel/main.nf'
workflow test_gatk4_calibratedragstrmodel_bam {
input = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
[]
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
strtablefile = file(params.test_data['homo_sapiens']['genome']['genome_strtablefile'], checkIfExists: true)
GATK4_CALIBRATEDRAGSTRMODEL ( input, fasta, fasta_fai, dict, strtablefile )
}
workflow test_gatk4_calibratedragstrmodel_cram {
input = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
[]
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
strtablefile = file(params.test_data['homo_sapiens']['genome']['genome_strtablefile'], checkIfExists: true)
GATK4_CALIBRATEDRAGSTRMODEL ( input, fasta, fasta_fai, dict, strtablefile )
}
workflow test_gatk4_calibratedragstrmodel_beds {
input = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
strtablefile = file(params.test_data['homo_sapiens']['genome']['genome_strtablefile'], checkIfExists: true)
GATK4_CALIBRATEDRAGSTRMODEL ( input, fasta, fasta_fai, dict, strtablefile )
}

View file

@ -0,0 +1,5 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
}

View file

@ -0,0 +1,26 @@
- name: gatk4 calibratedragstrmodel test_gatk4_calibratedragstrmodel_bam
command: nextflow run ./tests/modules/gatk4/calibratedragstrmodel -entry test_gatk4_calibratedragstrmodel_bam -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/calibratedragstrmodel/nextflow.config
tags:
- gatk4/calibratedragstrmodel
- gatk4
files:
- path: output/gatk4/test.txt
md5sum: 0a1a1583b157fa2251dd931ed165da4f
- name: gatk4 calibratedragstrmodel test_gatk4_calibratedragstrmodel_cram
command: nextflow run ./tests/modules/gatk4/calibratedragstrmodel -entry test_gatk4_calibratedragstrmodel_cram -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/calibratedragstrmodel/nextflow.config
tags:
- gatk4/calibratedragstrmodel
- gatk4
files:
- path: output/gatk4/test.txt
md5sum: 1aa7ab38023f724877b3323c5e6b9a4e
- name: gatk4 calibratedragstrmodel test_gatk4_calibratedragstrmodel_beds
command: nextflow run ./tests/modules/gatk4/calibratedragstrmodel -entry test_gatk4_calibratedragstrmodel_beds -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/calibratedragstrmodel/nextflow.config
tags:
- gatk4/calibratedragstrmodel
- gatk4
files:
- path: output/gatk4/test.txt
md5sum: def8baccad7bd59006f08fcb0a6721bf

View file

@ -0,0 +1,16 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { GATK4_COMPOSESTRTABLEFILE } from '../../../../modules/gatk4/composestrtablefile/main.nf'
workflow test_gatk4_composestrtablefile {
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
GATK4_COMPOSESTRTABLEFILE ( fasta, fasta_fai, dict )
}

View file

@ -0,0 +1,5 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
}

View file

@ -0,0 +1,7 @@
- name: gatk4 composestrtablefile test_gatk4_composestrtablefile
command: nextflow run ./tests/modules/gatk4/composestrtablefile -entry test_gatk4_composestrtablefile -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/composestrtablefile/nextflow.config
tags:
- gatk4/composestrtablefile
- gatk4
files:
- path: output/gatk4/genome.zip

View file

@ -8,6 +8,7 @@ workflow test_gatk4_haplotypecaller {
input = [ [ id:'test' ], // meta map input = [ [ id:'test' ], // meta map
file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true),
[],
[] []
] ]
fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
@ -21,6 +22,7 @@ workflow test_gatk4_haplotypecaller_cram {
input = [ [ id:'test' ], // meta map input = [ [ id:'test' ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
[],
[] []
] ]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
@ -34,7 +36,8 @@ workflow test_gatk4_haplotypecaller_intervals_dbsnp {
input = [ [ id:'test' ], // meta map input = [ [ id:'test' ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true),
[]
] ]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
@ -45,3 +48,20 @@ workflow test_gatk4_haplotypecaller_intervals_dbsnp {
GATK4_HAPLOTYPECALLER ( input, fasta, fai, dict, sites, sites_tbi ) GATK4_HAPLOTYPECALLER ( input, fasta, fai, dict, sites, sites_tbi )
} }
workflow test_gatk4_haplotypecaller_dragstr_model {
input = [ [ id:'test' ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true),
[],
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_dragstrmodel'], checkIfExists: true)
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
sites = []
sites_tbi = []
GATK4_HAPLOTYPECALLER ( input, fasta, fai, dict, sites, sites_tbi )
}

View file

@ -6,7 +6,6 @@
files: files:
- path: output/gatk4/test.vcf.gz - path: output/gatk4/test.vcf.gz
- path: output/gatk4/test.vcf.gz.tbi - path: output/gatk4/test.vcf.gz.tbi
- path: output/gatk4/versions.yml
- name: gatk4 haplotypecaller test_gatk4_haplotypecaller_cram - name: gatk4 haplotypecaller test_gatk4_haplotypecaller_cram
command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_cram -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_cram -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config
@ -16,7 +15,6 @@
files: files:
- path: output/gatk4/test.vcf.gz - path: output/gatk4/test.vcf.gz
- path: output/gatk4/test.vcf.gz.tbi - path: output/gatk4/test.vcf.gz.tbi
- path: output/gatk4/versions.yml
- name: gatk4 haplotypecaller test_gatk4_haplotypecaller_intervals_dbsnp - name: gatk4 haplotypecaller test_gatk4_haplotypecaller_intervals_dbsnp
command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_intervals_dbsnp -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_intervals_dbsnp -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config
@ -26,4 +24,12 @@
files: files:
- path: output/gatk4/test.vcf.gz - path: output/gatk4/test.vcf.gz
- path: output/gatk4/test.vcf.gz.tbi - path: output/gatk4/test.vcf.gz.tbi
- path: output/gatk4/versions.yml
- name: gatk4 haplotypecaller test_gatk4_haplotypecaller_dragstr_model
command: nextflow run ./tests/modules/gatk4/haplotypecaller -entry test_gatk4_haplotypecaller_dragstr_model -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/haplotypecaller/nextflow.config
tags:
- gatk4/haplotypecaller
- gatk4
files:
- path: output/gatk4/test.vcf.gz
- path: output/gatk4/test.vcf.gz.tbi

View file

@ -6,6 +6,8 @@
files: files:
- path: output/gatk4/test.vcf.gz - path: output/gatk4/test.vcf.gz
md5sum: 5b289bda88d3a3504f2e19ee8cff177c md5sum: 5b289bda88d3a3504f2e19ee8cff177c
- path: output/gatk4/test.vcf.gz.tbi
md5sum: a81673763b13086cfce9a23e72a35a16
- path: output/gatk4/versions.yml - path: output/gatk4/versions.yml
- name: gatk4 mergevcfs test_gatk4_mergevcfs_no_dict - name: gatk4 mergevcfs test_gatk4_mergevcfs_no_dict

View file

@ -36,7 +36,7 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: b9f5e2f6a624b64c300fe25dc3ac801f md5sum: 63de6af2210e138b49d7b4d570c6e67f
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out
@ -80,7 +80,7 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: 38d08f0b944a2a1b981a250d675aa0d9 md5sum: 7cdef439bc8092bfefb4d091bf8ee6ab
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out
@ -124,7 +124,7 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: c740d5177067c1fcc48ab7a16cd639d7 md5sum: 5dbc36fce7b72628c809bbc7d3d67973
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out
@ -168,9 +168,9 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: a1bd1b40950a58ea2776908076160052 md5sum: d85858bf55a523121dde762046a34c5c
- path: output/star/test.Chimeric.out.junction - path: output/star/test.Chimeric.out.junction
md5sum: 327629eb54032212f29e1c32cbac6975 md5sum: ae87d1a24180f5a35cf6b47fdfdd0539
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out

View file

@ -12,3 +12,13 @@ workflow test_untar {
UNTAR ( input ) UNTAR ( input )
} }
workflow test_untar_different_output_path {
input = [
[],
file(params.test_data['homo_sapiens']['illumina']['test_flowcell'], checkIfExists: true)
]
UNTAR ( input )
}

View file

@ -1,5 +1,5 @@
- name: untar - name: untar test_untar
command: nextflow run ./tests/modules/untar -entry test_untar -c ./tests/config/nextflow.config -c ./tests/modules/untar/nextflow.config command: nextflow run ./tests/modules/untar -entry test_untar -c ./tests/config/nextflow.config -c ./tests/modules/untar/nextflow.config
tags: tags:
- untar - untar
files: files:
@ -9,3 +9,11 @@
md5sum: a033d00cf6759407010b21700938f543 md5sum: a033d00cf6759407010b21700938f543
- path: output/untar/kraken2/taxo.k2d - path: output/untar/kraken2/taxo.k2d
md5sum: 094d5891cdccf2f1468088855c214b2c md5sum: 094d5891cdccf2f1468088855c214b2c
- name: untar test_untar_different_output_path
command: nextflow run ./tests/modules/untar -entry test_untar_different_output_path -c ./tests/config/nextflow.config -c ./tests/modules/untar/nextflow.config
tags:
- untar
files:
- path: output/untar/flowcell/RunInfo.xml
md5sum: 03038959f4dd181c86bc97ae71fe270a

View file

@ -0,0 +1,25 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
workflow test_vsearch_usearchglobal {
query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
idcutoff = 0.985
outoption = "xcfert" // Nonsense text to check default case.
columns = ""
VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
}
workflow test_vsearch_usearchglobal_userout {
query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
idcutoff = 0.985
outoption = "userout"
columns = "query+target+id"
VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
}

View file

@ -0,0 +1,4 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
}

View file

@ -0,0 +1,26 @@
- name: vsearch usearchglobal test_vsearch_usearchglobal
command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
tags:
- vsearch/usearchglobal
- vsearch
files:
- path: output/vsearch/test.aln
contains:
- "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
- "Query >lcl|MT192765.1_cds_QIK50427.1_2"
- "%Id TLen Target"
- "100% 29829 MT192765.1"
- "Query 3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
- "Target 29829nt >MT192765.1"
- "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
- "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
- "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
tags:
- vsearch/usearchglobal
- vsearch
files:
- path: output/vsearch/test.tsv
md5sum: b6cc50f7c8d18cb82e74dab70ed4baab