Merge pull request #1705 from jtangrot/vsearch_usearch_global

Vsearch usearch global

modules/vsearch/usearchglobal/main.nf

@@ -0,0 +1,67 @@
+process VSEARCH_USEARCHGLOBAL {
+    tag "${meta.id}"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
+        'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
+
+    input:
+    tuple val(meta), path(queryfasta)
+    path db
+    val idcutoff
+    val outoption
+    val user_columns
+
+    output:
+    tuple val(meta), path('*.aln')    , optional: true, emit: aln
+    tuple val(meta), path('*.biom')   , optional: true, emit: biom
+    tuple val(meta), path('*.lca')    , optional: true, emit: lca
+    tuple val(meta), path('*.mothur') , optional: true, emit: mothur
+    tuple val(meta), path('*.otu')    , optional: true, emit: otu
+    tuple val(meta), path('*.sam')    , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')    , optional: true, emit: tsv
+    tuple val(meta), path('*.txt')    , optional: true, emit: txt
+    tuple val(meta), path('*.uc')     , optional: true, emit: uc
+    path "versions.yml"                               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def columns = user_columns ? "--userfields ${user_columns}" : ''
+    switch ( outoption ) {
+        case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
+        case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
+        case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
+        case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
+        case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+        case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+        case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
+        case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
+        default:
+            outfmt = "--alnout";
+            out_ext = 'aln';
+            log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
+            break
+    }
+    """
+    vsearch \\
+        --usearch_global $queryfasta \\
+        --db $db \\
+        --id $idcutoff \\
+        --threads $task.cpus \\
+        $args \\
+        ${columns} \\
+        ${outfmt} ${prefix}.${out_ext}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
+    END_VERSIONS
+    """
+}

modules/vsearch/usearchglobal/meta.yml

@@ -0,0 +1,83 @@
+name: "vsearch_usearchglobal"
+description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
+keywords:
+  - vsearch
+  - usearch
+  - alignment
+  - fasta
+tools:
+  - "vsearch":
+      description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
+      homepage: "https://github.com/torognes/vsearch"
+      documentation: "None"
+      tool_dev_url: "https://github.com/torognes/vsearch"
+      doi: "doi: 10.7717/peerj.2584"
+      licence: "['GPL v3-or-later OR BSD-2-clause']"
+
+input:
+  - meta:
+      type: map
+      description: Groovy Map containing sample information e.g. [ id:'test' ]
+  - queryfasta:
+      type: file
+      description: Query sequences in FASTA format
+      pattern: "*.{fasta,fa,fna,faa}"
+  - db:
+      type: file
+      description: Reference database file in FASTA or UDB format
+      pattern: "*"
+  - idcutoff:
+      type: real
+      description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
+  - outoption:
+      type: string
+      description: Specify the type of output file to be generated by selecting one of the vsearch output file options
+      pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
+  - user_columns:
+      type: string
+      description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
+
+output:
+  - aln:
+      type: file
+      description: Results in pairwise alignment format
+      pattern: "*.{aln}"
+  - biom:
+      type: file
+      description: Results in an OTU table in the biom version 1.0 file format
+      pattern: "*.{biom}"
+  - lca:
+      type: file
+      description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
+      pattern: "*.{lca}"
+  - mothur:
+      type: file
+      description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format
+      pattern: "*.{mothur}"
+  - otu:
+      type: file
+      description: Results in an OTU table in the classic tab-separated plain text format
+      pattern: "*.{otu}"
+  - sam:
+      type: file
+      description: Results written in sam format
+      pattern: "*.{sam}"
+  - tsv:
+      type: file
+      description: Results in tab-separated output, columns defined by user
+      pattern: "*.{tsv}"
+  - txt:
+      type: file
+      description: Tab delimited results in blast-like tabular format
+      pattern: "*.{txt}"
+  - uc:
+      type: file
+      description: Tab delimited results in a uclust-like format with 10 columns
+      pattern: "*.{uc}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+
+authors:
+  - "@jtangrot"

tests/config/pytest_modules.yml

@@ -2052,6 +2052,10 @@ vcftools:
   - modules/vcftools/**
   - tests/modules/vcftools/**
 
+vsearch/usearchglobal:
+  - modules/vsearch/usearchglobal/**
+  - tests/modules/vsearch/usearchglobal/**
+
 yara/index:
   - modules/yara/index/**
   - tests/modules/yara/index/**

tests/modules/vsearch/usearchglobal/main.nf

@@ -0,0 +1,25 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
+
+workflow test_vsearch_usearchglobal {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "xcfert"  // Nonsense text to check default case.
+    columns = "" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}
+
+workflow test_vsearch_usearchglobal_userout {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "userout"
+    columns = "query+target+id" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}

tests/modules/vsearch/usearchglobal/nextflow.config

@@ -0,0 +1,4 @@
+process {
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+} 
+

tests/modules/vsearch/usearchglobal/test.yml

@@ -0,0 +1,26 @@
+- name: vsearch usearchglobal test_vsearch_usearchglobal
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.aln
+      contains:
+        - "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
+        - "Query >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "%Id   TLen  Target"
+        - "100%  29829  MT192765.1"
+        - "Query  3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "Target 29829nt >MT192765.1"
+        - "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
+        - "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
+        - "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
+
+- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.tsv
+      md5sum: b6cc50f7c8d18cb82e74dab70ed4baab