From 8d5680a6b782d97b359a4d2702259b71f96f5441 Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 23 May 2022 10:01:55 +0200
Subject: [PATCH 01/31] Add vserach usearch_global

---
 modules/vsearch/usearchglobal/main.nf         | 51 +++++++++++++++++++
 modules/vsearch/usearchglobal/meta.yml        | 38 ++++++++++++++
 tests/config/pytest_modules.yml               |  4 ++
 tests/modules/vsearch/usearchglobal/main.nf   | 12 +++++
 .../vsearch/usearchglobal/nextflow.config     |  5 ++
 tests/modules/vsearch/usearchglobal/test.yml  |  7 +++
 .../vsearch/usearchglobal/test.yml.ori        | 14 +++++
 7 files changed, 131 insertions(+)
 create mode 100644 modules/vsearch/usearchglobal/main.nf
 create mode 100644 modules/vsearch/usearchglobal/meta.yml
 create mode 100644 tests/modules/vsearch/usearchglobal/main.nf
 create mode 100644 tests/modules/vsearch/usearchglobal/nextflow.config
 create mode 100644 tests/modules/vsearch/usearchglobal/test.yml
 create mode 100644 tests/modules/vsearch/usearchglobal/test.yml.ori

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
new file mode 100644
index 00000000..65ee62cc
--- /dev/null
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -0,0 +1,51 @@
+// TODO nf-core: A module file SHOULD only define input and output files as command-line parameters.
+//               All other parameters MUST be provided using the "task.ext" directive, see here:
+//               https://www.nextflow.io/docs/latest/process.html#ext
+//               where "task.ext" is a string.
+//               Any parameters that need to be evaluated in the context of a particular sample
+//               e.g. single-end/paired-end data MUST also be defined and evaluated appropriately.
+// TODO nf-core: Software that can be piped together SHOULD be added to separate module files
+//               unless there is a run-time, storage advantage in implementing in this way
+//               e.g. it's ok to have a single module for bwa to output BAM instead of SAM:
+//                 bwa mem | samtools view -B -T ref.fasta
+
+process VSEARCH_USEARCHGLOBAL {
+    tag '$queryfasta'
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--hf1761c0_1':
+        'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
+
+    input:
+    path queryfasta
+    path db
+    val  outprefix
+
+    // TODO nf-core: Where applicable please provide/convert compressed files as input/output
+    //               e.g. "*.fastq.gz" and NOT "*.fastq", "*.bam" and NOT "*.sam" etc.
+
+    output:
+    path ("*.tsv")        , emit: tsv
+    path "versions.yml"   , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    """
+    vsearch \\
+        --usearch_global $queryfasta \\
+        --db $db \\
+        --threads $task.cpus \\
+        $args \\
+        --blast6out ${outprefix}.tsv
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
+    END_VERSIONS
+    """
+}
diff --git a/modules/vsearch/usearchglobal/meta.yml b/modules/vsearch/usearchglobal/meta.yml
new file mode 100644
index 00000000..8cb97446
--- /dev/null
+++ b/modules/vsearch/usearchglobal/meta.yml
@@ -0,0 +1,38 @@
+name: "vsearch_usearchglobal"
+description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
+keywords:
+  - vsearch
+  - usearch
+  - alignment
+  - fasta
+tools:
+  - "vsearch":
+      description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
+      homepage: "https://github.com/torognes/vsearch"
+      documentation: "None"
+      tool_dev_url: "https://github.com/torognes/vsearch"
+      doi: "doi: 10.7717/peerj.2584"
+      licence: "['GPL v3-or-later OR BSD-2-clause']"
+
+input:
+  - queryfasta:
+      type: file
+      description: Query sequences in FASTA format
+      pattern: "*.{fasta,fa,fna,faa}"
+  - db:
+      type: file
+      description: Reference database file. It may be in FASTA or UDB format.
+      pattern: "*"
+
+output:
+  - blast6out:
+      type: file
+      description: Tab delimited results in blast-like format
+      pattern: "*.{tsv}" 
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+
+authors:
+  - "@jtangrot"
diff --git a/tests/config/pytest_modules.yml b/tests/config/pytest_modules.yml
index 2d0d3226..05188329 100644
--- a/tests/config/pytest_modules.yml
+++ b/tests/config/pytest_modules.yml
@@ -2024,6 +2024,10 @@ vcftools:
   - modules/vcftools/**
   - tests/modules/vcftools/**
 
+vsearch/usearchglobal:
+  - modules/vsearch/usearchglobal/**
+  - tests/modules/vsearch/usearchglobal/**
+
 yara/index:
   - modules/yara/index/**
   - tests/modules/yara/index/**
diff --git a/tests/modules/vsearch/usearchglobal/main.nf b/tests/modules/vsearch/usearchglobal/main.nf
new file mode 100644
index 00000000..02becd21
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@@ -0,0 +1,12 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
+
+workflow test_vsearch_usearchglobal {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    VSEARCH_USEARCHGLOBAL ( query, db, "blast6out_results" )
+}
diff --git a/tests/modules/vsearch/usearchglobal/nextflow.config b/tests/modules/vsearch/usearchglobal/nextflow.config
new file mode 100644
index 00000000..aab29979
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/nextflow.config
@@ -0,0 +1,5 @@
+process {
+    ext.args = '--id 0.985'
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}
\ No newline at end of file
diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
new file mode 100644
index 00000000..b013519d
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -0,0 +1,7 @@
+- name: vsearch usearchglobal test_vsearch_usearchglobal
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+  files:
+    - path: output/vsearch/blast6out_results.tsv
+      md5sum: 09733131643f1d951321a6e17a35eb8c
diff --git a/tests/modules/vsearch/usearchglobal/test.yml.ori b/tests/modules/vsearch/usearchglobal/test.yml.ori
new file mode 100644
index 00000000..df644165
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/test.yml.ori
@@ -0,0 +1,14 @@
+## TODO nf-core: Please run the following command to build this file:
+#                nf-core modules create-test-yml vsearch/usearchglobal
+- name: "vsearch usearchglobal"
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - "vsearch"
+    #
+    - "vsearch/usearchglobal"
+    #
+  files:
+    - path: "output/vsearch/blast6out_results.tsv"
+      md5sum: e667c7caad0bc4b7ac383fd023c654fc
+    - path: output/vsearch/versions.yml
+      md5sum: a01fe51bc4c6a3a6226fbf77b2c7cf3b

From 853b76d16a263b314e5807f675d532b5cc1a68d6 Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 23 May 2022 14:02:10 +0200
Subject: [PATCH 02/31] Add options for output file type

---
 modules/vsearch/usearchglobal/main.nf         | 38 +++++++++++++++----
 tests/modules/vsearch/usearchglobal/main.nf   | 14 ++++++-
 .../vsearch/usearchglobal/nextflow.config     |  4 +-
 tests/modules/vsearch/usearchglobal/test.yml  | 14 ++++++-
 4 files changed, 58 insertions(+), 12 deletions(-)

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
index 65ee62cc..0b31842f 100644
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -10,7 +10,7 @@
 //                 bwa mem | samtools view -B -T ref.fasta
 
 process VSEARCH_USEARCHGLOBAL {
-    tag '$queryfasta'
+    tag "$meta.id"
     label 'process_low'
 
     conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
@@ -19,29 +19,53 @@ process VSEARCH_USEARCHGLOBAL {
         'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
 
     input:
-    path queryfasta
+    tuple val(meta), path(queryfasta)
     path db
-    val  outprefix
+    val outoption
+    val user_columns
 
     // TODO nf-core: Where applicable please provide/convert compressed files as input/output
     //               e.g. "*.fastq.gz" and NOT "*.fastq", "*.bam" and NOT "*.sam" etc.
 
     output:
-    path ("*.tsv")        , emit: tsv
-    path "versions.yml"   , emit: versions
-
+    tuple val(meta), path('*.aln')  , optional: true, emit: aln
+    tuple val(meta), path('*.biom') , optional: true, emit: biom
+    tuple val(meta), path('*.sam')  , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')  , optional: true, emit: tsv
+    tuple val(meta), path('*.uc')   , optional: true, emit: uc
+    path "versions.yml"                             , emit: versions
+    
     when:
     task.ext.when == null || task.ext.when
 
     script:
     def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def columns = user_columns ? "--userfields ${user_columns}" : ''
+    switch ( outoption ) {
+        case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
+        case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
+	case "blast6out": outfmt = "--blast6out"; out_ext = 'blast6out.tsv'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur.tsv'; break
+	case "otutabout": outfmt = "--otutabout"; out_ext = 'otu.tsv'; break
+	case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+	case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+	case "userout": outfmt = "--userout"; out_ext = 'user.tsv'; break
+	case "lcaout": outfmt = "--lcaout"; out_ext = 'lca.tsv'; break
+        default:
+            outfmt = "--alnout";
+            out_ext = 'aln';
+            log.warn("Unknown output file format provided (${outoption}): selectingpairwise alignments (alnout)");
+            break
+    }
     """
     vsearch \\
         --usearch_global $queryfasta \\
         --db $db \\
         --threads $task.cpus \\
         $args \\
-        --blast6out ${outprefix}.tsv
+        ${columns} \\
+        ${outfmt} ${prefix}.${out_ext}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/tests/modules/vsearch/usearchglobal/main.nf b/tests/modules/vsearch/usearchglobal/main.nf
index 02becd21..cdf0fb2f 100644
--- a/tests/modules/vsearch/usearchglobal/main.nf
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@@ -8,5 +8,17 @@ workflow test_vsearch_usearchglobal {
     
     query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
     db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-    VSEARCH_USEARCHGLOBAL ( query, db, "blast6out_results" )
+    
+    outoption = "xcfert"  // Nonsense text to check default case.
+    columns = "" 
+    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
+}
+
+workflow test_vsearch_usearchglobal_userout {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    outoption = "userout"
+    columns = "query+target+id" 
+    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
 }
diff --git a/tests/modules/vsearch/usearchglobal/nextflow.config b/tests/modules/vsearch/usearchglobal/nextflow.config
index aab29979..3148a59e 100644
--- a/tests/modules/vsearch/usearchglobal/nextflow.config
+++ b/tests/modules/vsearch/usearchglobal/nextflow.config
@@ -1,5 +1,5 @@
 process {
     ext.args = '--id 0.985'
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
-    
-}
\ No newline at end of file
+} 
+
diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
index b013519d..b7ebec4a 100644
--- a/tests/modules/vsearch/usearchglobal/test.yml
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -1,7 +1,17 @@
 - name: vsearch usearchglobal test_vsearch_usearchglobal
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
   tags:
+    - vsearch
     - vsearch/usearchglobal
   files:
-    - path: output/vsearch/blast6out_results.tsv
-      md5sum: 09733131643f1d951321a6e17a35eb8c
+    - path: output/vsearch/test.aln
+      md5sum: 7b7479c16e0ecb503913da8bde48d6c5
+
+- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch
+    - vsearch/usearchglobal
+  files:
+    - path: output/vsearch/test.user.tsv
+      md5sum: b6cc50f7c8d18cb82e74dab70ed4baab

From f1fc7fc38eb65782cdf2d05bc4d56a11ec8922a8 Mon Sep 17 00:00:00 2001
From: jvhagey <qpk9@cdc.gov>
Date: Tue, 24 May 2022 15:15:07 -0400
Subject: [PATCH 03/31] adding upzip

---
 modules/gamma/{ => gamma}/main.nf             | 15 ++++++++--
 modules/gamma/{ => gamma}/meta.yml            |  0
 tests/modules/gamma/gamma/main.nf             | 29 +++++++++++++++++++
 .../modules/gamma/{ => gamma}/nextflow.config |  0
 tests/modules/gamma/gamma/test.yml            | 29 +++++++++++++++++++
 tests/modules/gamma/main.nf                   | 17 -----------
 tests/modules/gamma/test.yml                  | 13 ---------
 7 files changed, 71 insertions(+), 32 deletions(-)
 rename modules/gamma/{ => gamma}/main.nf (83%)
 rename modules/gamma/{ => gamma}/meta.yml (100%)
 create mode 100644 tests/modules/gamma/gamma/main.nf
 rename tests/modules/gamma/{ => gamma}/nextflow.config (100%)
 create mode 100644 tests/modules/gamma/gamma/test.yml
 delete mode 100644 tests/modules/gamma/main.nf
 delete mode 100644 tests/modules/gamma/test.yml

diff --git a/modules/gamma/main.nf b/modules/gamma/gamma/main.nf
similarity index 83%
rename from modules/gamma/main.nf
rename to modules/gamma/gamma/main.nf
index e176ee68..51a5f6c8 100644
--- a/modules/gamma/main.nf
+++ b/modules/gamma/gamma/main.nf
@@ -26,13 +26,24 @@ process GAMMA {
     script:
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
+
     """
-    GAMMA.py \\
+    if [[ ${fasta} == *.gz ]]
+    then
+        FNAME=\$(basename ${fasta} .gz)
+        gunzip -f ${fasta}
+        GAMMA.py \\
+        $args \\
+        "\${FNAME}" \\
+        $db \\
+        $prefix
+    else
+        GAMMA.py \\
         $args \\
         $fasta \\
         $db \\
         $prefix
-
+    fi
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         gamma: $VERSION
diff --git a/modules/gamma/meta.yml b/modules/gamma/gamma/meta.yml
similarity index 100%
rename from modules/gamma/meta.yml
rename to modules/gamma/gamma/meta.yml
diff --git a/tests/modules/gamma/gamma/main.nf b/tests/modules/gamma/gamma/main.nf
new file mode 100644
index 00000000..070a3bf1
--- /dev/null
+++ b/tests/modules/gamma/gamma/main.nf
@@ -0,0 +1,29 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GAMMA } from '../../../../modules/gamma/gamma/main.nf'
+
+workflow test_unzip {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['bacteroides_fragilis']['illumina']['test1_contigs_fa_gz'], checkIfExists: true),
+    ]
+
+    db = [ file("https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/delete_me/srst2/ResGANNCBI_20210507_srst2.fasta", checkIfExists: true), ]
+
+    GAMMA ( input, db )
+}
+
+workflow test_gamma {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    ]
+
+    db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
+
+    GAMMA ( input, db )
+}
diff --git a/tests/modules/gamma/nextflow.config b/tests/modules/gamma/gamma/nextflow.config
similarity index 100%
rename from tests/modules/gamma/nextflow.config
rename to tests/modules/gamma/gamma/nextflow.config
diff --git a/tests/modules/gamma/gamma/test.yml b/tests/modules/gamma/gamma/test.yml
new file mode 100644
index 00000000..308d890f
--- /dev/null
+++ b/tests/modules/gamma/gamma/test.yml
@@ -0,0 +1,29 @@
+- name: gamma gamma test_unzip
+  command: nextflow run tests/modules/gamma/gamma -entry test_unzip -c tests/config/nextflow.config
+  tags:
+    - gamma/gamma
+    - gamma
+  files:
+    - path: /tmp/tmppm1ybfln/gamma/test.fasta
+      md5sum: 5b3b831d863fffaa3410a9ee7bfa12ce
+    - path: /tmp/tmppm1ybfln/gamma/test.gamma
+      md5sum: 46165a89e10b7315d3a9b0aa6c561626
+    - path: /tmp/tmppm1ybfln/gamma/test.psl
+      md5sum: f489ce4602ddbcb692d5781ee3fbf449
+    - path: /tmp/tmppm1ybfln/gamma/versions.yml
+      md5sum: ad23c3ec60663598543cbe8bc74bc4ab
+
+- name: gamma gamma test_gamma
+  command: nextflow run tests/modules/gamma/gamma -entry test_gamma -c tests/config/nextflow.config
+  tags:
+    - gamma/gamma
+    - gamma
+  files:
+    - path: /tmp/tmpw3chm6da/gamma/test.fasta
+      md5sum: df37b48466181311e0a679f3c5878484
+    - path: /tmp/tmpw3chm6da/gamma/test.gamma
+      md5sum: 3256708fa517a65ed01d99e0e3c762ae
+    - path: /tmp/tmpw3chm6da/gamma/test.psl
+      md5sum: 162a2757ed3b167ae1e0cdb24213f940
+    - path: /tmp/tmpw3chm6da/gamma/versions.yml
+      md5sum: 3fefb5b46c94993362243c5f9a472057
diff --git a/tests/modules/gamma/main.nf b/tests/modules/gamma/main.nf
deleted file mode 100644
index f9477706..00000000
--- a/tests/modules/gamma/main.nf
+++ /dev/null
@@ -1,17 +0,0 @@
-#!/usr/bin/env nextflow
-
-nextflow.enable.dsl = 2
-
-include { GAMMA } from '../../../modules/gamma/main.nf'
-
-workflow test_gamma {
-    
-    input = [
-        [ id:'test', single_end:false ], // meta map
-        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-    ]
-
-    db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
-
-    GAMMA ( input, db )
-}
diff --git a/tests/modules/gamma/test.yml b/tests/modules/gamma/test.yml
deleted file mode 100644
index 1b493b49..00000000
--- a/tests/modules/gamma/test.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-- name: gamma test_gamma
-  command: nextflow run tests/modules/gamma -entry test_gamma -c tests/config/nextflow.config
-  tags:
-    - gamma
-  files:
-    - path: output/gamma/test.fasta
-      md5sum: df37b48466181311e0a679f3c5878484
-    - path: output/gamma/test.gamma
-      md5sum: 3256708fa517a65ed01d99e0e3c762ae
-    - path: output/gamma/test.psl
-      md5sum: 162a2757ed3b167ae1e0cdb24213f940
-    - path: output/gamma/versions.yml
-      md5sum: 3fefb5b46c94993362243c5f9a472057

From b8aaea7429e74cb23acff21b03ba3814d7905ed1 Mon Sep 17 00:00:00 2001
From: jvhagey <qpk9@cdc.gov>
Date: Tue, 24 May 2022 16:27:00 -0400
Subject: [PATCH 04/31] updating paths in test.yml

---
 modules/gamma/gamma/main.nf        |  2 +-
 modules/gamma/gamma/meta.yml       |  3 ++-
 tests/modules/gamma/gamma/main.nf  |  6 +++---
 tests/modules/gamma/gamma/test.yml | 20 ++++++++++----------
 4 files changed, 16 insertions(+), 15 deletions(-)

diff --git a/modules/gamma/gamma/main.nf b/modules/gamma/gamma/main.nf
index 51a5f6c8..fddced62 100644
--- a/modules/gamma/gamma/main.nf
+++ b/modules/gamma/gamma/main.nf
@@ -1,6 +1,6 @@
 def VERSION = '2.1' // Version information not provided by tool on CLI
 
-process GAMMA {
+process GAMMA_GAMMA {
     tag "$meta.id"
     label 'process_low'
 
diff --git a/modules/gamma/gamma/meta.yml b/modules/gamma/gamma/meta.yml
index 316b685b..d9e272e2 100644
--- a/modules/gamma/gamma/meta.yml
+++ b/modules/gamma/gamma/meta.yml
@@ -1,4 +1,4 @@
-name: "gamma"
+name: "gamma_gamma"
 description: Gene Allele Mutation Microbial Assessment
 keywords:
   - gamma
@@ -61,3 +61,4 @@ output:
 authors:
   - "@sateeshperi"
   - "@rastanton"
+  - "@jvhagey"
diff --git a/tests/modules/gamma/gamma/main.nf b/tests/modules/gamma/gamma/main.nf
index 070a3bf1..97e58be7 100644
--- a/tests/modules/gamma/gamma/main.nf
+++ b/tests/modules/gamma/gamma/main.nf
@@ -2,7 +2,7 @@
 
 nextflow.enable.dsl = 2
 
-include { GAMMA } from '../../../../modules/gamma/gamma/main.nf'
+include { GAMMA_GAMMA } from '../../../../modules/gamma/gamma/main.nf'
 
 workflow test_unzip {
 
@@ -13,7 +13,7 @@ workflow test_unzip {
 
     db = [ file("https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/delete_me/srst2/ResGANNCBI_20210507_srst2.fasta", checkIfExists: true), ]
 
-    GAMMA ( input, db )
+    GAMMA_GAMMA ( input, db )
 }
 
 workflow test_gamma {
@@ -25,5 +25,5 @@ workflow test_gamma {
 
     db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
 
-    GAMMA ( input, db )
+    GAMMA_GAMMA ( input, db )
 }
diff --git a/tests/modules/gamma/gamma/test.yml b/tests/modules/gamma/gamma/test.yml
index 308d890f..2c649105 100644
--- a/tests/modules/gamma/gamma/test.yml
+++ b/tests/modules/gamma/gamma/test.yml
@@ -4,14 +4,14 @@
     - gamma/gamma
     - gamma
   files:
-    - path: /tmp/tmppm1ybfln/gamma/test.fasta
+    - path: output/gamma/gamma/test.fasta
       md5sum: 5b3b831d863fffaa3410a9ee7bfa12ce
-    - path: /tmp/tmppm1ybfln/gamma/test.gamma
+    - path: output/gamma/gamma/test.gamma
       md5sum: 46165a89e10b7315d3a9b0aa6c561626
-    - path: /tmp/tmppm1ybfln/gamma/test.psl
+    - path: output/gamma/gamma/test.psl
       md5sum: f489ce4602ddbcb692d5781ee3fbf449
-    - path: /tmp/tmppm1ybfln/gamma/versions.yml
-      md5sum: ad23c3ec60663598543cbe8bc74bc4ab
+    - path: output/gamma/gamma/versions.yml
+      md5sum: 8baafec7b3b87f788f69e30d317c9722
 
 - name: gamma gamma test_gamma
   command: nextflow run tests/modules/gamma/gamma -entry test_gamma -c tests/config/nextflow.config
@@ -19,11 +19,11 @@
     - gamma/gamma
     - gamma
   files:
-    - path: /tmp/tmpw3chm6da/gamma/test.fasta
+    - path: output/gamma/gamma/test.fasta
       md5sum: df37b48466181311e0a679f3c5878484
-    - path: /tmp/tmpw3chm6da/gamma/test.gamma
+    - path: output/gamma/gamma/test.gamma
       md5sum: 3256708fa517a65ed01d99e0e3c762ae
-    - path: /tmp/tmpw3chm6da/gamma/test.psl
+    - path: output/gamma/gamma/test.psl
       md5sum: 162a2757ed3b167ae1e0cdb24213f940
-    - path: /tmp/tmpw3chm6da/gamma/versions.yml
-      md5sum: 3fefb5b46c94993362243c5f9a472057
+    - path: output/gamma/gamma/versions.yml
+      md5sum: b75c2871d8cac2f8ac67c0fbd22babd6

From bb999395aa4d03d02336794c655cfcdf34855b05 Mon Sep 17 00:00:00 2001
From: jvhagey <qpk9@cdc.gov>
Date: Tue, 24 May 2022 19:19:38 -0400
Subject: [PATCH 05/31] fixed pytest_modules.yml

---
 tests/config/pytest_modules.yml | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/tests/config/pytest_modules.yml b/tests/config/pytest_modules.yml
index 2063d691..80711bae 100644
--- a/tests/config/pytest_modules.yml
+++ b/tests/config/pytest_modules.yml
@@ -707,9 +707,9 @@ freebayes:
   - modules/freebayes/**
   - tests/modules/freebayes/**
 
-gamma:
-  - modules/gamma/**
-  - tests/modules/gamma/**
+gamma/gamma:
+  - modules/gamma/gamma/**
+  - tests/modules/gamma/gamma/**
 
 gatk4/applybqsr:
   - modules/gatk4/applybqsr/**

From 127665d27ba5512bfe1596f86c2b11a197556233 Mon Sep 17 00:00:00 2001
From: jvhagey <qpk9@cdc.gov>
Date: Tue, 24 May 2022 19:27:09 -0400
Subject: [PATCH 06/31] fixed test.yml

---
 tests/modules/gamma/gamma/test.yml | 16 ++++++++--------
 1 file changed, 8 insertions(+), 8 deletions(-)

diff --git a/tests/modules/gamma/gamma/test.yml b/tests/modules/gamma/gamma/test.yml
index 2c649105..163eda5f 100644
--- a/tests/modules/gamma/gamma/test.yml
+++ b/tests/modules/gamma/gamma/test.yml
@@ -4,13 +4,13 @@
     - gamma/gamma
     - gamma
   files:
-    - path: output/gamma/gamma/test.fasta
+    - path: output/gamma/test.fasta
       md5sum: 5b3b831d863fffaa3410a9ee7bfa12ce
-    - path: output/gamma/gamma/test.gamma
+    - path: output/gamma/test.gamma
       md5sum: 46165a89e10b7315d3a9b0aa6c561626
-    - path: output/gamma/gamma/test.psl
+    - path: output/gamma/test.psl
       md5sum: f489ce4602ddbcb692d5781ee3fbf449
-    - path: output/gamma/gamma/versions.yml
+    - path: output/gamma/versions.yml
       md5sum: 8baafec7b3b87f788f69e30d317c9722
 
 - name: gamma gamma test_gamma
@@ -19,11 +19,11 @@
     - gamma/gamma
     - gamma
   files:
-    - path: output/gamma/gamma/test.fasta
+    - path: output/gamma/test.fasta
       md5sum: df37b48466181311e0a679f3c5878484
-    - path: output/gamma/gamma/test.gamma
+    - path: output/gamma/test.gamma
       md5sum: 3256708fa517a65ed01d99e0e3c762ae
-    - path: output/gamma/gamma/test.psl
+    - path: output/gamma/test.psl
       md5sum: 162a2757ed3b167ae1e0cdb24213f940
-    - path: output/gamma/gamma/versions.yml
+    - path: output/gamma/versions.yml
       md5sum: b75c2871d8cac2f8ac67c0fbd22babd6

From c452f562890534ca3d0a331de7c35b744037fdae Mon Sep 17 00:00:00 2001
From: Mahesh Binzer-Panchal <mahesh.binzer-panchal@nbis.se>
Date: Wed, 25 May 2022 12:29:14 +0000
Subject: [PATCH 07/31] Patch mash screen

---
 modules/mash/screen/main.nf        |  8 ++++----
 modules/mash/screen/meta.yml       |  9 +++++----
 tests/modules/mash/screen/main.nf  |  9 ++++++---
 tests/modules/mash/screen/test.yml | 10 +++++-----
 4 files changed, 20 insertions(+), 16 deletions(-)

diff --git a/modules/mash/screen/main.nf b/modules/mash/screen/main.nf
index 3e7859ed..be272cbb 100644
--- a/modules/mash/screen/main.nf
+++ b/modules/mash/screen/main.nf
@@ -8,8 +8,8 @@ process MASH_SCREEN {
         'quay.io/biocontainers/mash:2.3--he348c14_1' }"
 
     input:
-    tuple val(meta), path(query_sketch)
-    path fastx_db
+    tuple val(meta), path(query)
+    path sequences_sketch
 
     output:
     tuple val(meta), path("*.screen"), emit: screen
@@ -26,8 +26,8 @@ process MASH_SCREEN {
         screen \\
         $args \\
         -p $task.cpus \\
-        $query_sketch \\
-        $fastx_db \\
+        $sequences_sketch \\
+        $query \\
         > ${prefix}.screen
 
     cat <<-END_VERSIONS > versions.yml
diff --git a/modules/mash/screen/meta.yml b/modules/mash/screen/meta.yml
index 81e455bc..063aca6c 100644
--- a/modules/mash/screen/meta.yml
+++ b/modules/mash/screen/meta.yml
@@ -20,13 +20,14 @@ input:
       description: |
         Groovy Map containing sample information
         e.g. [ id:'test', single_end:false ]
-  - query_sketch:
+  - query:
       type: file
-      description: MinHash sketch of query sequences
-      pattern: "*.msh"
-  - fastx_db:
+      description: Query sequences
+      pattern: "*.fastq.gz"
+  - sequence_sketch:
       type: file
       description: Sequence files to match against
+      pattern: "*.msh"
 
 output:
   - meta:
diff --git a/tests/modules/mash/screen/main.nf b/tests/modules/mash/screen/main.nf
index 7f0b8bd9..5338d932 100644
--- a/tests/modules/mash/screen/main.nf
+++ b/tests/modules/mash/screen/main.nf
@@ -14,8 +14,11 @@ workflow test_mash_screen {
             file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
         ]
     ]
-    fastx_db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    sars_db = [
+        [ id: 'sars_db' ],
+        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    ]
 
-    MASH_SKETCH ( input )
-    MASH_SCREEN ( MASH_SKETCH.out.mash, fastx_db )
+    MASH_SKETCH ( sars_db )
+    MASH_SCREEN ( input, MASH_SKETCH.out.mash.map { meta, sketch -> sketch } )
 }
diff --git a/tests/modules/mash/screen/test.yml b/tests/modules/mash/screen/test.yml
index f622817a..e4907ce9 100644
--- a/tests/modules/mash/screen/test.yml
+++ b/tests/modules/mash/screen/test.yml
@@ -4,9 +4,9 @@
     - mash
     - mash/screen
   files:
-    - path: output/mash/test.mash_stats
-      md5sum: 2a6f297d8e69a5e4160243bc6c89129c
-    - path: output/mash/test.msh
-      md5sum: d747145a43dad5f82342036f8f5d9133
+    - path: output/mash/sars_db.mash_stats
+      md5sum: 1dafbd23e36e18bf4c87a007d0fc98f7
+    - path: output/mash/sars_db.msh
+      md5sum: 24289e4a13526e88eeb2abfca4a0f0a8
     - path: output/mash/test.screen
-      md5sum: d3c871dccd5cd57ab54781fa5c5d7278
+      md5sum: ac8701e1aab651b2f36c6380b1351b11

From 72ff2732e3177b041234aa49c1775376a00d59f4 Mon Sep 17 00:00:00 2001
From: Matthias De Smet <11850640+matthdsm@users.noreply.github.com>
Date: Wed, 25 May 2022 19:19:39 +0200
Subject: [PATCH 08/31] add all remaining outputs to mosdepth

---
 modules/mosdepth/main.nf               | 29 ++++++++++++------
 modules/mosdepth/meta.yml              | 16 ++++++++++
 tests/modules/mosdepth/main.nf         | 30 ++++++++++++++++--
 tests/modules/mosdepth/nextflow.config |  6 ++++
 tests/modules/mosdepth/test.yml        | 42 ++++++++++++++++++++++++++
 5 files changed, 111 insertions(+), 12 deletions(-)

diff --git a/modules/mosdepth/main.nf b/modules/mosdepth/main.nf
index 5f6538e7..96471cfc 100644
--- a/modules/mosdepth/main.nf
+++ b/modules/mosdepth/main.nf
@@ -13,15 +13,19 @@ process MOSDEPTH {
     path  fasta
 
     output:
-    tuple val(meta), path('*.global.dist.txt')    , emit: global_txt
-    tuple val(meta), path('*.region.dist.txt')    , emit: regions_txt , optional:true
-    tuple val(meta), path('*.summary.txt')        , emit: summary_txt
-    tuple val(meta), path('*.per-base.d4')        , emit: per_base_d4 , optional:true
-    tuple val(meta), path('*.per-base.bed.gz')    , emit: per_base_bed, optional:true
-    tuple val(meta), path('*.per-base.bed.gz.csi'), emit: per_base_csi, optional:true
-    tuple val(meta), path('*.regions.bed.gz')     , emit: regions_bed , optional:true
-    tuple val(meta), path('*.regions.bed.gz.csi') , emit: regions_csi , optional:true
-    path  "versions.yml"                          , emit: versions
+    tuple val(meta), path('*.global.dist.txt')      , emit: global_txt
+    tuple val(meta), path('*.region.dist.txt')      , emit: regions_txt , optional:true
+    tuple val(meta), path('*.summary.txt')          , emit: summary_txt
+    tuple val(meta), path('*.per-base.d4')          , emit: per_base_d4 , optional:true
+    tuple val(meta), path('*.per-base.bed.gz')      , emit: per_base_bed, optional:true
+    tuple val(meta), path('*.per-base.bed.gz.csi')  , emit: per_base_csi, optional:true
+    tuple val(meta), path('*.regions.bed.gz')       , emit: regions_bed , optional:true
+    tuple val(meta), path('*.regions.bed.gz.csi')   , emit: regions_csi , optional:true
+    tuple val(meta), path('*.quantized.bed.gz')     , emit: quantized_bed , optional:true
+    tuple val(meta), path('*.quantized.bed.gz.csi') , emit: quantized_csi , optional:true
+    tuple val(meta), path('*.thresholds.bed.gz')    , emit: thresholds_bed , optional:true
+    tuple val(meta), path('*.thresholds.bed.gz.csi'), emit: thresholds_csi , optional:true
+    path  "versions.yml"                            , emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -34,6 +38,9 @@ process MOSDEPTH {
     if (bed && args.contains("--by")) {
         exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
     }
+    if (!bed && args.contains("--thresholds")) {
+        exit 1, "'--thresholds' can only be specified in conjunction with '--by'"
+    }
 
     """
     mosdepth \\
@@ -61,6 +68,10 @@ process MOSDEPTH {
     touch ${prefix}.per-base.bed.gz.csi
     touch ${prefix}.regions.bed.gz
     touch ${prefix}.regions.bed.gz.csi
+    touch ${prefix}.quantized.bed.gz
+    touch ${prefix}.quantized.bed.gz.csi
+    touch ${prefix}.thresholds.bed.gz
+    touch ${prefix}.thresholds.bed.gz.csi
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/modules/mosdepth/meta.yml b/modules/mosdepth/meta.yml
index 6e9e34c9..d1e33447 100644
--- a/modules/mosdepth/meta.yml
+++ b/modules/mosdepth/meta.yml
@@ -72,6 +72,22 @@ output:
       type: file
       description: Index file for BED file with per-region coverage
       pattern: "*.{regions.bed.gz.csi}"
+  - quantized_bed:
+      type: file
+      description: BED file with binned coverage
+      pattern: "*.{quantized.bed.gz}"
+  - quantized_csi:
+      type: file
+      description: Index file for BED file with binned coverage
+      pattern: "*.{quantized.bed.gz.csi}"
+  - thresholds_bed:
+      type: file
+      description: BED file with the number of bases in each region that are covered at or above each threshold
+      pattern: "*.{thresholds.bed.gz}"
+  - thresholds_csi:
+      type: file
+      description: Index file for BED file with threshold coverage
+      pattern: "*.{thresholds.bed.gz.csi}"
   - versions:
       type: file
       description: File containing software versions
diff --git a/tests/modules/mosdepth/main.nf b/tests/modules/mosdepth/main.nf
index 96a9ef20..dd4a01c4 100644
--- a/tests/modules/mosdepth/main.nf
+++ b/tests/modules/mosdepth/main.nf
@@ -2,9 +2,12 @@
 
 nextflow.enable.dsl = 2
 
-include { MOSDEPTH                    } from '../../../modules/mosdepth/main.nf'
-include { MOSDEPTH as MOSDEPTH_FAIL   } from '../../../modules/mosdepth/main.nf'
-include { MOSDEPTH as MOSDEPTH_WINDOW } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH                       } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_FAIL      } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_WINDOW    } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_THRESHOLD } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_QUANTIZED } from '../../../modules/mosdepth/main.nf'
+
 
 workflow test_mosdepth {
     input  = [
@@ -61,6 +64,27 @@ workflow test_mosdepth_window {
     MOSDEPTH_WINDOW ( input, [], [] )
 }
 
+workflow test_mosdepth_quantized {
+    input  = [
+                [ id:'test', single_end:true ],
+                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+            ]
+
+    MOSDEPTH_QUANTIZED ( input, [], [] )
+}
+
+workflow test_mosdepth_thresholds {
+    input  = [
+                [ id:'test', single_end:true ],
+                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
+                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
+            ]
+    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+
+    MOSDEPTH_THRESHOLD ( input, bed, [] )
+}
+
 workflow test_mosdepth_fail {
     input  = [
                 [ id:'test', single_end:true ],
diff --git a/tests/modules/mosdepth/nextflow.config b/tests/modules/mosdepth/nextflow.config
index 4a6153e6..66e9291f 100644
--- a/tests/modules/mosdepth/nextflow.config
+++ b/tests/modules/mosdepth/nextflow.config
@@ -7,4 +7,10 @@ process {
     withName: MOSDEPTH_WINDOW {
         ext.args = "--by 100"
     }
+    withName: MOSDEPTH_QUANTIZED {
+        ext.args = "--quantize 0:1:4:100:200"
+    }
+    withName: MOSDEPTH_THRESHOLD {
+        ext.args = "--thresholds 1,10,20,30"
+    }
 }
diff --git a/tests/modules/mosdepth/test.yml b/tests/modules/mosdepth/test.yml
index a3115d6e..8efadb9d 100644
--- a/tests/modules/mosdepth/test.yml
+++ b/tests/modules/mosdepth/test.yml
@@ -86,6 +86,48 @@
     - path: output/mosdepth/test.regions.bed.gz.csi
       md5sum: 257d67678136963d9dd904330079609d
 
+- name: mosdepth test_mosdepth_quantized
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_quantized -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 4f0d231060cbde4efdd673863bd2fb59
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.quantized.bed.gz
+      md5sum: 3e434a8bafcf59a67841ae3d4d752838
+    - path: output/mosdepth/test.quantized.bed.gz.csi
+      md5sum: be9617f551f19a33923f1e886eaefb93
+
+- name: mosdepth test_mosdepth_thresholds
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_thresholds -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.region.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 96c037f769974b904beb53edc4f56d82
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.regions.bed.gz
+      md5sum: 5d398caf7171ec4406278e2add3009ae
+    - path: output/mosdepth/test.regions.bed.gz.csi
+      md5sum: 47669cfe41f3e222e74d81e1b1be191f
+    - path: output/mosdepth/test.thresholds.bed.gz
+      md5sum: 13101e326eea3cbfa1d569b69f494f4c
+    - path: output/mosdepth/test.thresholds.bed.gz.csi
+      md5sum: 912055ee9452229439df6fae95644196
+
 - name: mosdepth test_mosdepth_fail
   command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_fail -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
   tags:

From 241a1de035d47529fd09835f3f619490308afc21 Mon Sep 17 00:00:00 2001
From: Harshil Patel <drpatelh@users.noreply.github.com>
Date: Wed, 25 May 2022 19:38:12 +0100
Subject: [PATCH 09/31] Update main.nf

---
 tests/modules/mosdepth/main.nf | 93 +++++++++++++++++-----------------
 1 file changed, 46 insertions(+), 47 deletions(-)

diff --git a/tests/modules/mosdepth/main.nf b/tests/modules/mosdepth/main.nf
index dd4a01c4..1bb8e8ff 100644
--- a/tests/modules/mosdepth/main.nf
+++ b/tests/modules/mosdepth/main.nf
@@ -8,90 +8,89 @@ include { MOSDEPTH as MOSDEPTH_WINDOW    } from '../../../modules/mosdepth/main.
 include { MOSDEPTH as MOSDEPTH_THRESHOLD } from '../../../modules/mosdepth/main.nf'
 include { MOSDEPTH as MOSDEPTH_QUANTIZED } from '../../../modules/mosdepth/main.nf'
 
-
 workflow test_mosdepth {
-    input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-            ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
 
     MOSDEPTH ( input, [], [] )
 }
 
 workflow test_mosdepth_bed {
-    input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-            ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH ( input, bed, [] )
 }
 
 workflow test_mosdepth_cram {
-    input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
-            ]
-    fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
+    ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
 
     MOSDEPTH ( input, [], fasta )
 }
 
 workflow test_mosdepth_cram_bed {
     input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) ]
-            ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
-    fasta = [ file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ]
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
 
     MOSDEPTH ( input, bed, fasta )
 }
 
 workflow test_mosdepth_window {
-    input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-            ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH_WINDOW ( input, [], [] )
 }
 
 workflow test_mosdepth_quantized {
-    input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-            ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
 
     MOSDEPTH_QUANTIZED ( input, [], [] )
 }
 
 workflow test_mosdepth_thresholds {
-    input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-            ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH_THRESHOLD ( input, bed, [] )
 }
 
 workflow test_mosdepth_fail {
-    input  = [
-                [ id:'test', single_end:true ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-                [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-            ]
-    bed  = [ file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true) ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
 
     MOSDEPTH_FAIL ( input, bed, [] )
 }

From 72a31b76eb1b58879e0d91fb1d992e0118693098 Mon Sep 17 00:00:00 2001
From: Harshil Patel <drpatelh@users.noreply.github.com>
Date: Wed, 25 May 2022 19:42:15 +0100
Subject: [PATCH 10/31] Update main.nf

---
 modules/mosdepth/main.nf | 22 +++++++++++-----------
 1 file changed, 11 insertions(+), 11 deletions(-)

diff --git a/modules/mosdepth/main.nf b/modules/mosdepth/main.nf
index 96471cfc..d7e3c929 100644
--- a/modules/mosdepth/main.nf
+++ b/modules/mosdepth/main.nf
@@ -14,17 +14,17 @@ process MOSDEPTH {
 
     output:
     tuple val(meta), path('*.global.dist.txt')      , emit: global_txt
-    tuple val(meta), path('*.region.dist.txt')      , emit: regions_txt , optional:true
     tuple val(meta), path('*.summary.txt')          , emit: summary_txt
-    tuple val(meta), path('*.per-base.d4')          , emit: per_base_d4 , optional:true
-    tuple val(meta), path('*.per-base.bed.gz')      , emit: per_base_bed, optional:true
-    tuple val(meta), path('*.per-base.bed.gz.csi')  , emit: per_base_csi, optional:true
-    tuple val(meta), path('*.regions.bed.gz')       , emit: regions_bed , optional:true
-    tuple val(meta), path('*.regions.bed.gz.csi')   , emit: regions_csi , optional:true
-    tuple val(meta), path('*.quantized.bed.gz')     , emit: quantized_bed , optional:true
-    tuple val(meta), path('*.quantized.bed.gz.csi') , emit: quantized_csi , optional:true
-    tuple val(meta), path('*.thresholds.bed.gz')    , emit: thresholds_bed , optional:true
-    tuple val(meta), path('*.thresholds.bed.gz.csi'), emit: thresholds_csi , optional:true
+    tuple val(meta), path('*.region.dist.txt')      , optional:true, emit: regions_txt
+    tuple val(meta), path('*.per-base.d4')          , optional:true, emit: per_base_d4
+    tuple val(meta), path('*.per-base.bed.gz')      , optional:true, emit: per_base_bed
+    tuple val(meta), path('*.per-base.bed.gz.csi')  , optional:true, emit: per_base_csi
+    tuple val(meta), path('*.regions.bed.gz')       , optional:true, emit: regions_bed
+    tuple val(meta), path('*.regions.bed.gz.csi')   , optional:true, emit: regions_csi
+    tuple val(meta), path('*.quantized.bed.gz')     , optional:true, emit: quantized_bed
+    tuple val(meta), path('*.quantized.bed.gz.csi') , optional:true, emit: quantized_csi
+    tuple val(meta), path('*.thresholds.bed.gz')    , optional:true, emit: thresholds_bed
+    tuple val(meta), path('*.thresholds.bed.gz.csi'), optional:true, emit: thresholds_csi
     path  "versions.yml"                            , emit: versions
 
     when:
@@ -44,7 +44,7 @@ process MOSDEPTH {
 
     """
     mosdepth \\
-        --threads ${task.cpus} \\
+        --threads $task.cpus \\
         $interval \\
         $reference \\
         $args \\

From 05e4e2cddec05c58e7a807e03a8e751456eef572 Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Thu, 26 May 2022 20:16:45 +0200
Subject: [PATCH 11/31] Add idcutoff as input

---
 modules/vsearch/usearchglobal/main.nf         | 53 ++++++++-----------
 modules/vsearch/usearchglobal/meta.yml        | 51 ++++++++++++++++--
 tests/modules/vsearch/usearchglobal/main.nf   |  7 +--
 .../vsearch/usearchglobal/nextflow.config     |  1 -
 tests/modules/vsearch/usearchglobal/test.yml  |  8 +--
 .../vsearch/usearchglobal/test.yml.ori        | 14 -----
 6 files changed, 79 insertions(+), 55 deletions(-)
 delete mode 100644 tests/modules/vsearch/usearchglobal/test.yml.ori

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
index 0b31842f..ed95b7c3 100644
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -1,39 +1,31 @@
-// TODO nf-core: A module file SHOULD only define input and output files as command-line parameters.
-//               All other parameters MUST be provided using the "task.ext" directive, see here:
-//               https://www.nextflow.io/docs/latest/process.html#ext
-//               where "task.ext" is a string.
-//               Any parameters that need to be evaluated in the context of a particular sample
-//               e.g. single-end/paired-end data MUST also be defined and evaluated appropriately.
-// TODO nf-core: Software that can be piped together SHOULD be added to separate module files
-//               unless there is a run-time, storage advantage in implementing in this way
-//               e.g. it's ok to have a single module for bwa to output BAM instead of SAM:
-//                 bwa mem | samtools view -B -T ref.fasta
-
 process VSEARCH_USEARCHGLOBAL {
-    tag "$meta.id"
+    tag "${meta.id}"
     label 'process_low'
 
     conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--hf1761c0_1':
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
         'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
 
     input:
-    tuple val(meta), path(queryfasta)
+    val(meta)
+    path(queryfasta)
     path db
+    val idcutoff
     val outoption
     val user_columns
 
-    // TODO nf-core: Where applicable please provide/convert compressed files as input/output
-    //               e.g. "*.fastq.gz" and NOT "*.fastq", "*.bam" and NOT "*.sam" etc.
-
     output:
-    tuple val(meta), path('*.aln')  , optional: true, emit: aln
-    tuple val(meta), path('*.biom') , optional: true, emit: biom
-    tuple val(meta), path('*.sam')  , optional: true, emit: sam
-    tuple val(meta), path('*.tsv')  , optional: true, emit: tsv
-    tuple val(meta), path('*.uc')   , optional: true, emit: uc
-    path "versions.yml"                             , emit: versions
+    tuple val(meta), path('*.aln')    , optional: true, emit: aln
+    tuple val(meta), path('*.biom')   , optional: true, emit: biom
+    tuple val(meta), path('*.lca')    , optional: true, emit: lca
+    tuple val(meta), path('*.mothur') , optional: true, emit: mothur
+    tuple val(meta), path('*.otu')    , optional: true, emit: otu
+    tuple val(meta), path('*.sam')    , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')    , optional: true, emit: tsv
+    tuple val(meta), path('*.txt')    , optional: true, emit: txt
+    tuple val(meta), path('*.uc')     , optional: true, emit: uc
+    path "versions.yml"                               , emit: versions
     
     when:
     task.ext.when == null || task.ext.when
@@ -45,13 +37,13 @@ process VSEARCH_USEARCHGLOBAL {
     switch ( outoption ) {
         case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
         case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
-	case "blast6out": outfmt = "--blast6out"; out_ext = 'blast6out.tsv'; break
-        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur.tsv'; break
-	case "otutabout": outfmt = "--otutabout"; out_ext = 'otu.tsv'; break
-	case "samout": outfmt = "--samout"; out_ext = 'sam'; break
-	case "uc": outfmt = "--uc"; out_ext = 'uc'; break
-	case "userout": outfmt = "--userout"; out_ext = 'user.tsv'; break
-	case "lcaout": outfmt = "--lcaout"; out_ext = 'lca.tsv'; break
+        case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
+        case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
+        case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+        case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+        case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
+        case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
         default:
             outfmt = "--alnout";
             out_ext = 'aln';
@@ -62,6 +54,7 @@ process VSEARCH_USEARCHGLOBAL {
     vsearch \\
         --usearch_global $queryfasta \\
         --db $db \\
+        --id $idcutoff \\
         --threads $task.cpus \\
         $args \\
         ${columns} \\
diff --git a/modules/vsearch/usearchglobal/meta.yml b/modules/vsearch/usearchglobal/meta.yml
index 8cb97446..848fb65a 100644
--- a/modules/vsearch/usearchglobal/meta.yml
+++ b/modules/vsearch/usearchglobal/meta.yml
@@ -15,20 +15,65 @@ tools:
       licence: "['GPL v3-or-later OR BSD-2-clause']"
 
 input:
+  - meta:
+      type: map
+      description: Groovy Map containing sample information e.g. [ id:'test' ]
   - queryfasta:
       type: file
       description: Query sequences in FASTA format
       pattern: "*.{fasta,fa,fna,faa}"
   - db:
       type: file
-      description: Reference database file. It may be in FASTA or UDB format.
+      description: Reference database file in FASTA or UDB format
       pattern: "*"
+  - idcutoff:
+      type: real
+      description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
+  - outoption:
+      type: string
+      description: Specify the type of output file to be generated by selecting one of the vsearch output file options
+      pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
+  - user_columns:
+      type: string
+      description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
 
 output:
-  - blast6out:
+  - aln:
       type: file
-      description: Tab delimited results in blast-like format
+      description: Results in pairwise alignment format
+      pattern: "*.{aln}"
+  - biom:
+      type: file
+      description: Results in an OTU table in the biom version 1.0 file format
+      pattern: "*.{biom}"
+  - lca:
+      type: file
+      description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
+      pattern: "*.{lca}"
+  - mothur:
+      type: file
+      description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format
+      pattern: "*.{mothur}"
+  - otu:
+      type: file
+      description: Results in an OTU table in the classic tab-separated plain text format
+      pattern: "*.{otu}"
+  - sam:
+      type: file
+      description: Results written in sam format
+      pattern: "*.{sam}"
+  - tsv:
+      type: file
+      description: Results in tab-separated output, columns defined by user
       pattern: "*.{tsv}" 
+  - txt:
+      type: file
+      description: Tab delimited results in blast-like tabular format
+      pattern: "*.{txt}"
+  - uc:
+      type: file
+      description: Tab delimited results in a uclust-like format with 10 columns
+      pattern: "*.{uc}"
   - versions:
       type: file
       description: File containing software versions
diff --git a/tests/modules/vsearch/usearchglobal/main.nf b/tests/modules/vsearch/usearchglobal/main.nf
index cdf0fb2f..f4afec32 100644
--- a/tests/modules/vsearch/usearchglobal/main.nf
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@@ -8,17 +8,18 @@ workflow test_vsearch_usearchglobal {
     
     query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
     db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-    
+    idcutoff = 0.985
     outoption = "xcfert"  // Nonsense text to check default case.
     columns = "" 
-    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
+    VSEARCH_USEARCHGLOBAL ( [id:'test'], query, db, idcutoff, outoption, columns )
 }
 
 workflow test_vsearch_usearchglobal_userout {
     
     query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
     db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
     outoption = "userout"
     columns = "query+target+id" 
-    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
+    VSEARCH_USEARCHGLOBAL ( [id:'test'], query, db, idcutoff, outoption, columns )
 }
diff --git a/tests/modules/vsearch/usearchglobal/nextflow.config b/tests/modules/vsearch/usearchglobal/nextflow.config
index 3148a59e..14f46dea 100644
--- a/tests/modules/vsearch/usearchglobal/nextflow.config
+++ b/tests/modules/vsearch/usearchglobal/nextflow.config
@@ -1,5 +1,4 @@
 process {
-    ext.args = '--id 0.985'
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
 } 
 
diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
index b7ebec4a..79bcd50e 100644
--- a/tests/modules/vsearch/usearchglobal/test.yml
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -1,17 +1,17 @@
 - name: vsearch usearchglobal test_vsearch_usearchglobal
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
   tags:
-    - vsearch
     - vsearch/usearchglobal
+    - vsearch
   files:
     - path: output/vsearch/test.aln
-      md5sum: 7b7479c16e0ecb503913da8bde48d6c5
+      md5sum: 2543c4147530dcb1ba4550d3fdb1502a
 
 - name: vsearch usearchglobal test_vsearch_usearchglobal_userout
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
   tags:
-    - vsearch
     - vsearch/usearchglobal
+    - vsearch
   files:
-    - path: output/vsearch/test.user.tsv
+    - path: output/vsearch/test.tsv
       md5sum: b6cc50f7c8d18cb82e74dab70ed4baab
diff --git a/tests/modules/vsearch/usearchglobal/test.yml.ori b/tests/modules/vsearch/usearchglobal/test.yml.ori
deleted file mode 100644
index df644165..00000000
--- a/tests/modules/vsearch/usearchglobal/test.yml.ori
+++ /dev/null
@@ -1,14 +0,0 @@
-## TODO nf-core: Please run the following command to build this file:
-#                nf-core modules create-test-yml vsearch/usearchglobal
-- name: "vsearch usearchglobal"
-  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
-  tags:
-    - "vsearch"
-    #
-    - "vsearch/usearchglobal"
-    #
-  files:
-    - path: "output/vsearch/blast6out_results.tsv"
-      md5sum: e667c7caad0bc4b7ac383fd023c654fc
-    - path: output/vsearch/versions.yml
-      md5sum: a01fe51bc4c6a3a6226fbf77b2c7cf3b

From fb6c7bca3d55c19a793372513395e3a567bdd7ba Mon Sep 17 00:00:00 2001
From: Harshil Patel <drpatelhh@gmail.com>
Date: Fri, 27 May 2022 11:35:04 +0100
Subject: [PATCH 12/31] Bump container version for STAR to 2.7.10a

---
 modules/star/align/main.nf          | 13 +++++++------
 modules/star/genomegenerate/main.nf | 13 ++++++-------
 2 files changed, 13 insertions(+), 13 deletions(-)

diff --git a/modules/star/align/main.nf b/modules/star/align/main.nf
index 762b84f6..e5aa36f5 100644
--- a/modules/star/align/main.nf
+++ b/modules/star/align/main.nf
@@ -2,16 +2,15 @@ process STAR_ALIGN {
     tag "$meta.id"
     label 'process_high'
 
-    // Note: 2.7X indices incompatible with AWS iGenomes.
-    conda (params.enable_conda ? 'bioconda::star=2.7.9a' : null)
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/star:2.7.9a--h9ee0642_0' :
-        'quay.io/biocontainers/star:2.7.9a--h9ee0642_0' }"
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
 
     input:
     tuple val(meta), path(reads)
-    path  index
-    path  gtf
+    path index
+    path gtf
     val star_ignore_sjdbgtf
     val seq_platform
     val seq_center
@@ -67,6 +66,8 @@ process STAR_ALIGN {
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         star: \$(STAR --version | sed -e "s/STAR_//g")
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+        gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
     END_VERSIONS
     """
 }
diff --git a/modules/star/genomegenerate/main.nf b/modules/star/genomegenerate/main.nf
index e5568f1d..3c298016 100644
--- a/modules/star/genomegenerate/main.nf
+++ b/modules/star/genomegenerate/main.nf
@@ -2,19 +2,18 @@ process STAR_GENOMEGENERATE {
     tag "$fasta"
     label 'process_high'
 
-    // Note: 2.7X indices incompatible with AWS iGenomes.
-    conda (params.enable_conda ? "bioconda::star=2.7.9a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' :
-        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' }"
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
 
     input:
     path fasta
     path gtf
 
     output:
-    path "star"         , emit: index
-    path "versions.yml" , emit: versions
+    path "star"        , emit: index
+    path "versions.yml", emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -22,7 +21,7 @@ process STAR_GENOMEGENERATE {
     script:
     def args = task.ext.args ?: ''
     def args_list = args.tokenize()
-    def memory   = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
+    def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
     if (args_list.contains('--genomeSAindexNbases')) {
         """
         mkdir star

From ad578cafcc559b8a6a99257b91e85ba044d9f619 Mon Sep 17 00:00:00 2001
From: Harshil Patel <drpatelhh@gmail.com>
Date: Fri, 27 May 2022 12:14:10 +0100
Subject: [PATCH 13/31] Fix tests

---
 tests/modules/star/align/test.yml | 10 +++++-----
 1 file changed, 5 insertions(+), 5 deletions(-)

diff --git a/tests/modules/star/align/test.yml b/tests/modules/star/align/test.yml
index af5bebe5..f7cb0f62 100644
--- a/tests/modules/star/align/test.yml
+++ b/tests/modules/star/align/test.yml
@@ -36,7 +36,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: b9f5e2f6a624b64c300fe25dc3ac801f
+      md5sum: 63de6af2210e138b49d7b4d570c6e67f
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -80,7 +80,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: 38d08f0b944a2a1b981a250d675aa0d9
+      md5sum: 7cdef439bc8092bfefb4d091bf8ee6ab
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -124,7 +124,7 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: c740d5177067c1fcc48ab7a16cd639d7
+      md5sum: 5dbc36fce7b72628c809bbc7d3d67973
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out
@@ -168,9 +168,9 @@
     - path: output/star/star/transcriptInfo.tab
       md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
     - path: output/star/test.Aligned.out.bam
-      md5sum: a1bd1b40950a58ea2776908076160052
+      md5sum: d85858bf55a523121dde762046a34c5c
     - path: output/star/test.Chimeric.out.junction
-      md5sum: 327629eb54032212f29e1c32cbac6975
+      md5sum: ae87d1a24180f5a35cf6b47fdfdd0539
     - path: output/star/test.Log.final.out
     - path: output/star/test.Log.out
     - path: output/star/test.Log.progress.out

From 1c99ffd876a3a91c13764b7b9c26959d74eb1bea Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 23 May 2022 10:01:55 +0200
Subject: [PATCH 14/31] Add vserach usearch_global

---
 modules/vsearch/usearchglobal/main.nf         | 51 +++++++++++++++++++
 modules/vsearch/usearchglobal/meta.yml        | 38 ++++++++++++++
 tests/config/pytest_modules.yml               |  4 ++
 tests/modules/vsearch/usearchglobal/main.nf   | 12 +++++
 .../vsearch/usearchglobal/nextflow.config     |  5 ++
 tests/modules/vsearch/usearchglobal/test.yml  |  7 +++
 .../vsearch/usearchglobal/test.yml.ori        | 14 +++++
 7 files changed, 131 insertions(+)
 create mode 100644 modules/vsearch/usearchglobal/main.nf
 create mode 100644 modules/vsearch/usearchglobal/meta.yml
 create mode 100644 tests/modules/vsearch/usearchglobal/main.nf
 create mode 100644 tests/modules/vsearch/usearchglobal/nextflow.config
 create mode 100644 tests/modules/vsearch/usearchglobal/test.yml
 create mode 100644 tests/modules/vsearch/usearchglobal/test.yml.ori

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
new file mode 100644
index 00000000..65ee62cc
--- /dev/null
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -0,0 +1,51 @@
+// TODO nf-core: A module file SHOULD only define input and output files as command-line parameters.
+//               All other parameters MUST be provided using the "task.ext" directive, see here:
+//               https://www.nextflow.io/docs/latest/process.html#ext
+//               where "task.ext" is a string.
+//               Any parameters that need to be evaluated in the context of a particular sample
+//               e.g. single-end/paired-end data MUST also be defined and evaluated appropriately.
+// TODO nf-core: Software that can be piped together SHOULD be added to separate module files
+//               unless there is a run-time, storage advantage in implementing in this way
+//               e.g. it's ok to have a single module for bwa to output BAM instead of SAM:
+//                 bwa mem | samtools view -B -T ref.fasta
+
+process VSEARCH_USEARCHGLOBAL {
+    tag '$queryfasta'
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--hf1761c0_1':
+        'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
+
+    input:
+    path queryfasta
+    path db
+    val  outprefix
+
+    // TODO nf-core: Where applicable please provide/convert compressed files as input/output
+    //               e.g. "*.fastq.gz" and NOT "*.fastq", "*.bam" and NOT "*.sam" etc.
+
+    output:
+    path ("*.tsv")        , emit: tsv
+    path "versions.yml"   , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    """
+    vsearch \\
+        --usearch_global $queryfasta \\
+        --db $db \\
+        --threads $task.cpus \\
+        $args \\
+        --blast6out ${outprefix}.tsv
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
+    END_VERSIONS
+    """
+}
diff --git a/modules/vsearch/usearchglobal/meta.yml b/modules/vsearch/usearchglobal/meta.yml
new file mode 100644
index 00000000..8cb97446
--- /dev/null
+++ b/modules/vsearch/usearchglobal/meta.yml
@@ -0,0 +1,38 @@
+name: "vsearch_usearchglobal"
+description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
+keywords:
+  - vsearch
+  - usearch
+  - alignment
+  - fasta
+tools:
+  - "vsearch":
+      description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
+      homepage: "https://github.com/torognes/vsearch"
+      documentation: "None"
+      tool_dev_url: "https://github.com/torognes/vsearch"
+      doi: "doi: 10.7717/peerj.2584"
+      licence: "['GPL v3-or-later OR BSD-2-clause']"
+
+input:
+  - queryfasta:
+      type: file
+      description: Query sequences in FASTA format
+      pattern: "*.{fasta,fa,fna,faa}"
+  - db:
+      type: file
+      description: Reference database file. It may be in FASTA or UDB format.
+      pattern: "*"
+
+output:
+  - blast6out:
+      type: file
+      description: Tab delimited results in blast-like format
+      pattern: "*.{tsv}" 
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+
+authors:
+  - "@jtangrot"
diff --git a/tests/config/pytest_modules.yml b/tests/config/pytest_modules.yml
index 529f3e02..3ff58b5c 100644
--- a/tests/config/pytest_modules.yml
+++ b/tests/config/pytest_modules.yml
@@ -2052,6 +2052,10 @@ vcftools:
   - modules/vcftools/**
   - tests/modules/vcftools/**
 
+vsearch/usearchglobal:
+  - modules/vsearch/usearchglobal/**
+  - tests/modules/vsearch/usearchglobal/**
+
 yara/index:
   - modules/yara/index/**
   - tests/modules/yara/index/**
diff --git a/tests/modules/vsearch/usearchglobal/main.nf b/tests/modules/vsearch/usearchglobal/main.nf
new file mode 100644
index 00000000..02becd21
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@@ -0,0 +1,12 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
+
+workflow test_vsearch_usearchglobal {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    VSEARCH_USEARCHGLOBAL ( query, db, "blast6out_results" )
+}
diff --git a/tests/modules/vsearch/usearchglobal/nextflow.config b/tests/modules/vsearch/usearchglobal/nextflow.config
new file mode 100644
index 00000000..aab29979
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/nextflow.config
@@ -0,0 +1,5 @@
+process {
+    ext.args = '--id 0.985'
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}
\ No newline at end of file
diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
new file mode 100644
index 00000000..b013519d
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -0,0 +1,7 @@
+- name: vsearch usearchglobal test_vsearch_usearchglobal
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+  files:
+    - path: output/vsearch/blast6out_results.tsv
+      md5sum: 09733131643f1d951321a6e17a35eb8c
diff --git a/tests/modules/vsearch/usearchglobal/test.yml.ori b/tests/modules/vsearch/usearchglobal/test.yml.ori
new file mode 100644
index 00000000..df644165
--- /dev/null
+++ b/tests/modules/vsearch/usearchglobal/test.yml.ori
@@ -0,0 +1,14 @@
+## TODO nf-core: Please run the following command to build this file:
+#                nf-core modules create-test-yml vsearch/usearchglobal
+- name: "vsearch usearchglobal"
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - "vsearch"
+    #
+    - "vsearch/usearchglobal"
+    #
+  files:
+    - path: "output/vsearch/blast6out_results.tsv"
+      md5sum: e667c7caad0bc4b7ac383fd023c654fc
+    - path: output/vsearch/versions.yml
+      md5sum: a01fe51bc4c6a3a6226fbf77b2c7cf3b

From 589ce2d73a0b9a3109f5291587eff425ca7fbfa5 Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 23 May 2022 14:02:10 +0200
Subject: [PATCH 15/31] Add options for output file type

---
 modules/vsearch/usearchglobal/main.nf         | 38 +++++++++++++++----
 tests/modules/vsearch/usearchglobal/main.nf   | 14 ++++++-
 .../vsearch/usearchglobal/nextflow.config     |  4 +-
 tests/modules/vsearch/usearchglobal/test.yml  | 14 ++++++-
 4 files changed, 58 insertions(+), 12 deletions(-)

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
index 65ee62cc..0b31842f 100644
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -10,7 +10,7 @@
 //                 bwa mem | samtools view -B -T ref.fasta
 
 process VSEARCH_USEARCHGLOBAL {
-    tag '$queryfasta'
+    tag "$meta.id"
     label 'process_low'
 
     conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
@@ -19,29 +19,53 @@ process VSEARCH_USEARCHGLOBAL {
         'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
 
     input:
-    path queryfasta
+    tuple val(meta), path(queryfasta)
     path db
-    val  outprefix
+    val outoption
+    val user_columns
 
     // TODO nf-core: Where applicable please provide/convert compressed files as input/output
     //               e.g. "*.fastq.gz" and NOT "*.fastq", "*.bam" and NOT "*.sam" etc.
 
     output:
-    path ("*.tsv")        , emit: tsv
-    path "versions.yml"   , emit: versions
-
+    tuple val(meta), path('*.aln')  , optional: true, emit: aln
+    tuple val(meta), path('*.biom') , optional: true, emit: biom
+    tuple val(meta), path('*.sam')  , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')  , optional: true, emit: tsv
+    tuple val(meta), path('*.uc')   , optional: true, emit: uc
+    path "versions.yml"                             , emit: versions
+    
     when:
     task.ext.when == null || task.ext.when
 
     script:
     def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def columns = user_columns ? "--userfields ${user_columns}" : ''
+    switch ( outoption ) {
+        case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
+        case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
+	case "blast6out": outfmt = "--blast6out"; out_ext = 'blast6out.tsv'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur.tsv'; break
+	case "otutabout": outfmt = "--otutabout"; out_ext = 'otu.tsv'; break
+	case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+	case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+	case "userout": outfmt = "--userout"; out_ext = 'user.tsv'; break
+	case "lcaout": outfmt = "--lcaout"; out_ext = 'lca.tsv'; break
+        default:
+            outfmt = "--alnout";
+            out_ext = 'aln';
+            log.warn("Unknown output file format provided (${outoption}): selectingpairwise alignments (alnout)");
+            break
+    }
     """
     vsearch \\
         --usearch_global $queryfasta \\
         --db $db \\
         --threads $task.cpus \\
         $args \\
-        --blast6out ${outprefix}.tsv
+        ${columns} \\
+        ${outfmt} ${prefix}.${out_ext}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
diff --git a/tests/modules/vsearch/usearchglobal/main.nf b/tests/modules/vsearch/usearchglobal/main.nf
index 02becd21..cdf0fb2f 100644
--- a/tests/modules/vsearch/usearchglobal/main.nf
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@@ -8,5 +8,17 @@ workflow test_vsearch_usearchglobal {
     
     query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
     db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-    VSEARCH_USEARCHGLOBAL ( query, db, "blast6out_results" )
+    
+    outoption = "xcfert"  // Nonsense text to check default case.
+    columns = "" 
+    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
+}
+
+workflow test_vsearch_usearchglobal_userout {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    outoption = "userout"
+    columns = "query+target+id" 
+    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
 }
diff --git a/tests/modules/vsearch/usearchglobal/nextflow.config b/tests/modules/vsearch/usearchglobal/nextflow.config
index aab29979..3148a59e 100644
--- a/tests/modules/vsearch/usearchglobal/nextflow.config
+++ b/tests/modules/vsearch/usearchglobal/nextflow.config
@@ -1,5 +1,5 @@
 process {
     ext.args = '--id 0.985'
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
-    
-}
\ No newline at end of file
+} 
+
diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
index b013519d..b7ebec4a 100644
--- a/tests/modules/vsearch/usearchglobal/test.yml
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -1,7 +1,17 @@
 - name: vsearch usearchglobal test_vsearch_usearchglobal
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
   tags:
+    - vsearch
     - vsearch/usearchglobal
   files:
-    - path: output/vsearch/blast6out_results.tsv
-      md5sum: 09733131643f1d951321a6e17a35eb8c
+    - path: output/vsearch/test.aln
+      md5sum: 7b7479c16e0ecb503913da8bde48d6c5
+
+- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch
+    - vsearch/usearchglobal
+  files:
+    - path: output/vsearch/test.user.tsv
+      md5sum: b6cc50f7c8d18cb82e74dab70ed4baab

From 01d86439f5a25cd6b46006420ad7eb35049f4b27 Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Thu, 26 May 2022 20:16:45 +0200
Subject: [PATCH 16/31] Add idcutoff as input

---
 modules/vsearch/usearchglobal/main.nf         | 53 ++++++++-----------
 modules/vsearch/usearchglobal/meta.yml        | 51 ++++++++++++++++--
 tests/modules/vsearch/usearchglobal/main.nf   |  7 +--
 .../vsearch/usearchglobal/nextflow.config     |  1 -
 tests/modules/vsearch/usearchglobal/test.yml  |  8 +--
 .../vsearch/usearchglobal/test.yml.ori        | 14 -----
 6 files changed, 79 insertions(+), 55 deletions(-)
 delete mode 100644 tests/modules/vsearch/usearchglobal/test.yml.ori

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
index 0b31842f..ed95b7c3 100644
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -1,39 +1,31 @@
-// TODO nf-core: A module file SHOULD only define input and output files as command-line parameters.
-//               All other parameters MUST be provided using the "task.ext" directive, see here:
-//               https://www.nextflow.io/docs/latest/process.html#ext
-//               where "task.ext" is a string.
-//               Any parameters that need to be evaluated in the context of a particular sample
-//               e.g. single-end/paired-end data MUST also be defined and evaluated appropriately.
-// TODO nf-core: Software that can be piped together SHOULD be added to separate module files
-//               unless there is a run-time, storage advantage in implementing in this way
-//               e.g. it's ok to have a single module for bwa to output BAM instead of SAM:
-//                 bwa mem | samtools view -B -T ref.fasta
-
 process VSEARCH_USEARCHGLOBAL {
-    tag "$meta.id"
+    tag "${meta.id}"
     label 'process_low'
 
     conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--hf1761c0_1':
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
         'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
 
     input:
-    tuple val(meta), path(queryfasta)
+    val(meta)
+    path(queryfasta)
     path db
+    val idcutoff
     val outoption
     val user_columns
 
-    // TODO nf-core: Where applicable please provide/convert compressed files as input/output
-    //               e.g. "*.fastq.gz" and NOT "*.fastq", "*.bam" and NOT "*.sam" etc.
-
     output:
-    tuple val(meta), path('*.aln')  , optional: true, emit: aln
-    tuple val(meta), path('*.biom') , optional: true, emit: biom
-    tuple val(meta), path('*.sam')  , optional: true, emit: sam
-    tuple val(meta), path('*.tsv')  , optional: true, emit: tsv
-    tuple val(meta), path('*.uc')   , optional: true, emit: uc
-    path "versions.yml"                             , emit: versions
+    tuple val(meta), path('*.aln')    , optional: true, emit: aln
+    tuple val(meta), path('*.biom')   , optional: true, emit: biom
+    tuple val(meta), path('*.lca')    , optional: true, emit: lca
+    tuple val(meta), path('*.mothur') , optional: true, emit: mothur
+    tuple val(meta), path('*.otu')    , optional: true, emit: otu
+    tuple val(meta), path('*.sam')    , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')    , optional: true, emit: tsv
+    tuple val(meta), path('*.txt')    , optional: true, emit: txt
+    tuple val(meta), path('*.uc')     , optional: true, emit: uc
+    path "versions.yml"                               , emit: versions
     
     when:
     task.ext.when == null || task.ext.when
@@ -45,13 +37,13 @@ process VSEARCH_USEARCHGLOBAL {
     switch ( outoption ) {
         case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
         case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
-	case "blast6out": outfmt = "--blast6out"; out_ext = 'blast6out.tsv'; break
-        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur.tsv'; break
-	case "otutabout": outfmt = "--otutabout"; out_ext = 'otu.tsv'; break
-	case "samout": outfmt = "--samout"; out_ext = 'sam'; break
-	case "uc": outfmt = "--uc"; out_ext = 'uc'; break
-	case "userout": outfmt = "--userout"; out_ext = 'user.tsv'; break
-	case "lcaout": outfmt = "--lcaout"; out_ext = 'lca.tsv'; break
+        case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
+        case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
+        case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+        case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+        case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
+        case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
         default:
             outfmt = "--alnout";
             out_ext = 'aln';
@@ -62,6 +54,7 @@ process VSEARCH_USEARCHGLOBAL {
     vsearch \\
         --usearch_global $queryfasta \\
         --db $db \\
+        --id $idcutoff \\
         --threads $task.cpus \\
         $args \\
         ${columns} \\
diff --git a/modules/vsearch/usearchglobal/meta.yml b/modules/vsearch/usearchglobal/meta.yml
index 8cb97446..848fb65a 100644
--- a/modules/vsearch/usearchglobal/meta.yml
+++ b/modules/vsearch/usearchglobal/meta.yml
@@ -15,20 +15,65 @@ tools:
       licence: "['GPL v3-or-later OR BSD-2-clause']"
 
 input:
+  - meta:
+      type: map
+      description: Groovy Map containing sample information e.g. [ id:'test' ]
   - queryfasta:
       type: file
       description: Query sequences in FASTA format
       pattern: "*.{fasta,fa,fna,faa}"
   - db:
       type: file
-      description: Reference database file. It may be in FASTA or UDB format.
+      description: Reference database file in FASTA or UDB format
       pattern: "*"
+  - idcutoff:
+      type: real
+      description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
+  - outoption:
+      type: string
+      description: Specify the type of output file to be generated by selecting one of the vsearch output file options
+      pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
+  - user_columns:
+      type: string
+      description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
 
 output:
-  - blast6out:
+  - aln:
       type: file
-      description: Tab delimited results in blast-like format
+      description: Results in pairwise alignment format
+      pattern: "*.{aln}"
+  - biom:
+      type: file
+      description: Results in an OTU table in the biom version 1.0 file format
+      pattern: "*.{biom}"
+  - lca:
+      type: file
+      description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
+      pattern: "*.{lca}"
+  - mothur:
+      type: file
+      description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format
+      pattern: "*.{mothur}"
+  - otu:
+      type: file
+      description: Results in an OTU table in the classic tab-separated plain text format
+      pattern: "*.{otu}"
+  - sam:
+      type: file
+      description: Results written in sam format
+      pattern: "*.{sam}"
+  - tsv:
+      type: file
+      description: Results in tab-separated output, columns defined by user
       pattern: "*.{tsv}" 
+  - txt:
+      type: file
+      description: Tab delimited results in blast-like tabular format
+      pattern: "*.{txt}"
+  - uc:
+      type: file
+      description: Tab delimited results in a uclust-like format with 10 columns
+      pattern: "*.{uc}"
   - versions:
       type: file
       description: File containing software versions
diff --git a/tests/modules/vsearch/usearchglobal/main.nf b/tests/modules/vsearch/usearchglobal/main.nf
index cdf0fb2f..f4afec32 100644
--- a/tests/modules/vsearch/usearchglobal/main.nf
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@@ -8,17 +8,18 @@ workflow test_vsearch_usearchglobal {
     
     query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
     db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-    
+    idcutoff = 0.985
     outoption = "xcfert"  // Nonsense text to check default case.
     columns = "" 
-    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
+    VSEARCH_USEARCHGLOBAL ( [id:'test'], query, db, idcutoff, outoption, columns )
 }
 
 workflow test_vsearch_usearchglobal_userout {
     
     query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
     db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
     outoption = "userout"
     columns = "query+target+id" 
-    VSEARCH_USEARCHGLOBAL ( [ [id:'test'], query ], db, outoption, columns )
+    VSEARCH_USEARCHGLOBAL ( [id:'test'], query, db, idcutoff, outoption, columns )
 }
diff --git a/tests/modules/vsearch/usearchglobal/nextflow.config b/tests/modules/vsearch/usearchglobal/nextflow.config
index 3148a59e..14f46dea 100644
--- a/tests/modules/vsearch/usearchglobal/nextflow.config
+++ b/tests/modules/vsearch/usearchglobal/nextflow.config
@@ -1,5 +1,4 @@
 process {
-    ext.args = '--id 0.985'
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
 } 
 
diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
index b7ebec4a..79bcd50e 100644
--- a/tests/modules/vsearch/usearchglobal/test.yml
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -1,17 +1,17 @@
 - name: vsearch usearchglobal test_vsearch_usearchglobal
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
   tags:
-    - vsearch
     - vsearch/usearchglobal
+    - vsearch
   files:
     - path: output/vsearch/test.aln
-      md5sum: 7b7479c16e0ecb503913da8bde48d6c5
+      md5sum: 2543c4147530dcb1ba4550d3fdb1502a
 
 - name: vsearch usearchglobal test_vsearch_usearchglobal_userout
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
   tags:
-    - vsearch
     - vsearch/usearchglobal
+    - vsearch
   files:
-    - path: output/vsearch/test.user.tsv
+    - path: output/vsearch/test.tsv
       md5sum: b6cc50f7c8d18cb82e74dab70ed4baab
diff --git a/tests/modules/vsearch/usearchglobal/test.yml.ori b/tests/modules/vsearch/usearchglobal/test.yml.ori
deleted file mode 100644
index df644165..00000000
--- a/tests/modules/vsearch/usearchglobal/test.yml.ori
+++ /dev/null
@@ -1,14 +0,0 @@
-## TODO nf-core: Please run the following command to build this file:
-#                nf-core modules create-test-yml vsearch/usearchglobal
-- name: "vsearch usearchglobal"
-  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
-  tags:
-    - "vsearch"
-    #
-    - "vsearch/usearchglobal"
-    #
-  files:
-    - path: "output/vsearch/blast6out_results.tsv"
-      md5sum: e667c7caad0bc4b7ac383fd023c654fc
-    - path: output/vsearch/versions.yml
-      md5sum: a01fe51bc4c6a3a6226fbf77b2c7cf3b

From 2e16c90fce782bda854d2d638d0e216fc613ca39 Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 30 May 2022 09:57:05 +0200
Subject: [PATCH 17/31] Fix whitespace

---
 modules/vsearch/usearchglobal/main.nf  | 2 +-
 modules/vsearch/usearchglobal/meta.yml | 2 +-
 2 files changed, 2 insertions(+), 2 deletions(-)

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
index ed95b7c3..804ef223 100644
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -26,7 +26,7 @@ process VSEARCH_USEARCHGLOBAL {
     tuple val(meta), path('*.txt')    , optional: true, emit: txt
     tuple val(meta), path('*.uc')     , optional: true, emit: uc
     path "versions.yml"                               , emit: versions
-    
+
     when:
     task.ext.when == null || task.ext.when
 
diff --git a/modules/vsearch/usearchglobal/meta.yml b/modules/vsearch/usearchglobal/meta.yml
index 848fb65a..3b22e9cd 100644
--- a/modules/vsearch/usearchglobal/meta.yml
+++ b/modules/vsearch/usearchglobal/meta.yml
@@ -65,7 +65,7 @@ output:
   - tsv:
       type: file
       description: Results in tab-separated output, columns defined by user
-      pattern: "*.{tsv}" 
+      pattern: "*.{tsv}"
   - txt:
       type: file
       description: Tab delimited results in blast-like tabular format

From c67c15f243b6e590fb28275dbcc29f0d4ae6053c Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 30 May 2022 13:01:06 +0200
Subject: [PATCH 18/31] Make input tuple

---
 modules/vsearch/usearchglobal/main.nf       | 3 +--
 tests/modules/vsearch/usearchglobal/main.nf | 4 ++--
 2 files changed, 3 insertions(+), 4 deletions(-)

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
index 804ef223..88d945ea 100644
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -8,8 +8,7 @@ process VSEARCH_USEARCHGLOBAL {
         'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
 
     input:
-    val(meta)
-    path(queryfasta)
+    tuple val(meta), path(queryfasta)
     path db
     val idcutoff
     val outoption
diff --git a/tests/modules/vsearch/usearchglobal/main.nf b/tests/modules/vsearch/usearchglobal/main.nf
index f4afec32..90dc3191 100644
--- a/tests/modules/vsearch/usearchglobal/main.nf
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@@ -11,7 +11,7 @@ workflow test_vsearch_usearchglobal {
     idcutoff = 0.985
     outoption = "xcfert"  // Nonsense text to check default case.
     columns = "" 
-    VSEARCH_USEARCHGLOBAL ( [id:'test'], query, db, idcutoff, outoption, columns )
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
 }
 
 workflow test_vsearch_usearchglobal_userout {
@@ -21,5 +21,5 @@ workflow test_vsearch_usearchglobal_userout {
     idcutoff = 0.985
     outoption = "userout"
     columns = "query+target+id" 
-    VSEARCH_USEARCHGLOBAL ( [id:'test'], query, db, idcutoff, outoption, columns )
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
 }

From 69e00b55d39c2d4c1f4ef94fd5be972d8478c07c Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Jeanette=20T=C3=A5ngrot?= <jeanette.tangrot@umu.se>
Date: Mon, 30 May 2022 13:03:45 +0200
Subject: [PATCH 19/31] Update modules/vsearch/usearchglobal/main.nf

Co-authored-by: Daniel Straub <42973691+d4straub@users.noreply.github.com>
---
 modules/vsearch/usearchglobal/main.nf | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/modules/vsearch/usearchglobal/main.nf b/modules/vsearch/usearchglobal/main.nf
index 804ef223..01e379d2 100644
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@@ -47,7 +47,7 @@ process VSEARCH_USEARCHGLOBAL {
         default:
             outfmt = "--alnout";
             out_ext = 'aln';
-            log.warn("Unknown output file format provided (${outoption}): selectingpairwise alignments (alnout)");
+            log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
             break
     }
     """

From 6aac5c2c4099f950f43f9db7fa3b4b639c4c7ffc Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 30 May 2022 13:30:27 +0200
Subject: [PATCH 20/31] Update test

---
 tests/modules/vsearch/usearchglobal/test.yml | 11 ++++++++++-
 1 file changed, 10 insertions(+), 1 deletion(-)

diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
index 79bcd50e..a593f78f 100644
--- a/tests/modules/vsearch/usearchglobal/test.yml
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -5,7 +5,16 @@
     - vsearch
   files:
     - path: output/vsearch/test.aln
-      md5sum: 2543c4147530dcb1ba4550d3fdb1502a
+      contains:
+      - "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
+      - "Query >lcl|MT192765.1_cds_QIK50427.1_2"
+      - "%Id   TLen  Target"
+      - "100%  29829  MT192765.1"
+      - "Query  3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
+      - "Target 29829nt >MT192765.1"
+      - "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
+      - "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
+      - "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
 
 - name: vsearch usearchglobal test_vsearch_usearchglobal_userout
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config

From 6ae405c5dab57ca9ce3761bfd6f39d6bb8df9e20 Mon Sep 17 00:00:00 2001
From: jtangrot <jeanette.tangrot@umu.se>
Date: Mon, 30 May 2022 13:35:12 +0200
Subject: [PATCH 21/31] prettier

---
 tests/modules/vsearch/usearchglobal/test.yml | 18 +++++++++---------
 1 file changed, 9 insertions(+), 9 deletions(-)

diff --git a/tests/modules/vsearch/usearchglobal/test.yml b/tests/modules/vsearch/usearchglobal/test.yml
index a593f78f..227d728f 100644
--- a/tests/modules/vsearch/usearchglobal/test.yml
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@@ -6,15 +6,15 @@
   files:
     - path: output/vsearch/test.aln
       contains:
-      - "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
-      - "Query >lcl|MT192765.1_cds_QIK50427.1_2"
-      - "%Id   TLen  Target"
-      - "100%  29829  MT192765.1"
-      - "Query  3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
-      - "Target 29829nt >MT192765.1"
-      - "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
-      - "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
-      - "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
+        - "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
+        - "Query >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "%Id   TLen  Target"
+        - "100%  29829  MT192765.1"
+        - "Query  3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "Target 29829nt >MT192765.1"
+        - "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
+        - "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
+        - "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
 
 - name: vsearch usearchglobal test_vsearch_usearchglobal_userout
   command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config

From d463cd5dd676738e95363e46302918d366a6b6d2 Mon Sep 17 00:00:00 2001
From: Sebastien Guizard <sguizard@ed.ac.uk>
Date: Mon, 30 May 2022 17:26:51 +0100
Subject: [PATCH 22/31] =?UTF-8?q?=F0=9F=91=8C=20IMPROVE:=20Remove=20last?=
 =?UTF-8?q?=20TODO?=
MIME-Version: 1.0
Content-Type: text/plain; charset=UTF-8
Content-Transfer-Encoding: 8bit

---
 modules/bamtools/convert/meta.yml | 1 -
 1 file changed, 1 deletion(-)

diff --git a/modules/bamtools/convert/meta.yml b/modules/bamtools/convert/meta.yml
index 5796a4ab..dcd1cc65 100644
--- a/modules/bamtools/convert/meta.yml
+++ b/modules/bamtools/convert/meta.yml
@@ -42,7 +42,6 @@ output:
       type: file
       description: File containing software versions
       pattern: "versions.yml"
-  ## TODO nf-core: Delete / customise this example output
   - out:
       type: file
       description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml)

From 723852bf3d3b12059b2f53da8bc055206f3019d7 Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Tue, 31 May 2022 13:38:18 +0200
Subject: [PATCH 23/31] Fixes running without shortreads, and also ensures all
 tests produce non-empty fastq.gz files

---
 modules/filtlong/main.nf               |  2 +-
 tests/modules/filtlong/nextflow.config |  2 ++
 tests/modules/filtlong/test.yml        | 12 ++++++------
 3 files changed, 9 insertions(+), 7 deletions(-)

diff --git a/modules/filtlong/main.nf b/modules/filtlong/main.nf
index 0e6fdd53..67500053 100644
--- a/modules/filtlong/main.nf
+++ b/modules/filtlong/main.nf
@@ -20,7 +20,7 @@ process FILTLONG {
     script:
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
-    def short_reads = meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
+    def short_reads = !shortreads ? "" : meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
     """
     filtlong \\
         $short_reads \\
diff --git a/tests/modules/filtlong/nextflow.config b/tests/modules/filtlong/nextflow.config
index 8730f1c4..ec9854c2 100644
--- a/tests/modules/filtlong/nextflow.config
+++ b/tests/modules/filtlong/nextflow.config
@@ -2,4 +2,6 @@ process {
 
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
 
+    ext.args = "--min_length 10"
+
 }
diff --git a/tests/modules/filtlong/test.yml b/tests/modules/filtlong/test.yml
index dc5fa5a9..9c465303 100644
--- a/tests/modules/filtlong/test.yml
+++ b/tests/modules/filtlong/test.yml
@@ -1,23 +1,23 @@
 - name: filtlong test_filtlong
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
   tags:
     - filtlong
   files:
     - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+      md5sum: ff2b6e10fea0c45f10e8739a5bca25ed
 
 - name: filtlong test_filtlong_illumina_se
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
   tags:
     - filtlong
   files:
     - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+      md5sum: ff2b6e10fea0c45f10e8739a5bca25ed
 
 - name: filtlong test_filtlong_illumina_pe
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
   tags:
     - filtlong
   files:
     - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+      md5sum: ff2b6e10fea0c45f10e8739a5bca25ed

From 430def06faabbbbfe03da68661c329b85a1296ed Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Tue, 31 May 2022 14:45:41 +0200
Subject: [PATCH 24/31] Switch from md5sum to string due to conda flakiness

---
 tests/modules/filtlong/test.yml | 9 ++++++---
 1 file changed, 6 insertions(+), 3 deletions(-)

diff --git a/tests/modules/filtlong/test.yml b/tests/modules/filtlong/test.yml
index 9c465303..93f847ec 100644
--- a/tests/modules/filtlong/test.yml
+++ b/tests/modules/filtlong/test.yml
@@ -4,7 +4,8 @@
     - filtlong
   files:
     - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: ff2b6e10fea0c45f10e8739a5bca25ed
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
 
 - name: filtlong test_filtlong_illumina_se
   command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
@@ -12,7 +13,8 @@
     - filtlong
   files:
     - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: ff2b6e10fea0c45f10e8739a5bca25ed
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
 
 - name: filtlong test_filtlong_illumina_pe
   command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
@@ -20,4 +22,5 @@
     - filtlong
   files:
     - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: ff2b6e10fea0c45f10e8739a5bca25ed
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"

From 51b0a6e4f3b048a1eebeb86896fa0374771ca554 Mon Sep 17 00:00:00 2001
From: Nicolas Vannieuwkerke <nicolas.vannieuwkerke@ugent.be>
Date: Tue, 31 May 2022 15:15:58 +0200
Subject: [PATCH 25/31] Added optional input of index files to bcftools/concat

---
 modules/bcftools/concat/main.nf        |  2 +-
 modules/bcftools/concat/meta.yml       |  5 +++++
 tests/modules/bcftools/concat/main.nf  | 18 +++++++++++++++---
 tests/modules/bcftools/concat/test.yml | 15 ++++++++++++---
 4 files changed, 33 insertions(+), 7 deletions(-)

diff --git a/modules/bcftools/concat/main.nf b/modules/bcftools/concat/main.nf
index c0633ef7..257ee36f 100644
--- a/modules/bcftools/concat/main.nf
+++ b/modules/bcftools/concat/main.nf
@@ -8,7 +8,7 @@ process BCFTOOLS_CONCAT {
         'quay.io/biocontainers/bcftools:1.14--h88f3f91_0' }"
 
     input:
-    tuple val(meta), path(vcfs)
+    tuple val(meta), path(vcfs), path(tbi)
 
     output:
     tuple val(meta), path("*.gz"), emit: vcf
diff --git a/modules/bcftools/concat/meta.yml b/modules/bcftools/concat/meta.yml
index 3984276f..167dbe5a 100644
--- a/modules/bcftools/concat/meta.yml
+++ b/modules/bcftools/concat/meta.yml
@@ -25,6 +25,11 @@ input:
       description: |
         List containing 2 or more vcf files
         e.g. [ 'file1.vcf', 'file2.vcf' ]
+  - tbi:
+      type: files
+      description: |
+        List containing 2 or more index files (optional)
+        e.g. [ 'file1.tbi', 'file2.tbi' ]
 output:
   - meta:
       type: map
diff --git a/tests/modules/bcftools/concat/main.nf b/tests/modules/bcftools/concat/main.nf
index 8441d488..777dc5b8 100644
--- a/tests/modules/bcftools/concat/main.nf
+++ b/tests/modules/bcftools/concat/main.nf
@@ -4,13 +4,25 @@ nextflow.enable.dsl = 2
 
 include { BCFTOOLS_CONCAT } from '../../../../modules/bcftools/concat/main.nf'
 
-workflow test_bcftools_concat {
+workflow test_bcftools_concat_tbi {
     
     input = [ [ id:'test3' ], // meta map
               [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
-                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ]
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
+              [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true),
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz_tbi'], checkIfExists: true) ]
+            ]
+
+    BCFTOOLS_CONCAT ( input )
+}
+
+workflow test_bcftools_concat_no_tbi {
+    
+    input = [ [ id:'test3' ], // meta map
+              [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
+              []
             ]
 
-
     BCFTOOLS_CONCAT ( input )
 }
diff --git a/tests/modules/bcftools/concat/test.yml b/tests/modules/bcftools/concat/test.yml
index 7d04ebc6..0d12badc 100644
--- a/tests/modules/bcftools/concat/test.yml
+++ b/tests/modules/bcftools/concat/test.yml
@@ -1,8 +1,17 @@
-- name: bcftools concat test_bcftools_concat
-  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config
+- name: bcftools concat test_bcftools_concat_tbi
+  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_tbi -c ./tests/config/nextflow.config  -c ./tests/modules/bcftools/concat/nextflow.config
   tags:
-    - bcftools/concat
     - bcftools
+    - bcftools/concat
+  files:
+    - path: output/bcftools/test3.vcf.gz
+      md5sum: 35c88bfaad20101062e98beb217d7137
+
+- name: bcftools concat test_bcftools_concat_no_tbi
+  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_no_tbi -c ./tests/config/nextflow.config  -c ./tests/modules/bcftools/concat/nextflow.config
+  tags:
+    - bcftools
+    - bcftools/concat
   files:
     - path: output/bcftools/test3.vcf.gz
       md5sum: 35c88bfaad20101062e98beb217d7137

From 5513d095f5240a0240cd327e3b86fa619819d3d4 Mon Sep 17 00:00:00 2001
From: Anders Sune Pedersen <aspe@clin.au.dk>
Date: Tue, 31 May 2022 15:37:26 +0200
Subject: [PATCH 26/31] Adding tbi-files to the output from GATK4_MERGEVCFS.
 #1709

---
 modules/gatk4/mergevcfs/main.nf  | 1 +
 modules/gatk4/mergevcfs/meta.yml | 6 ++++++
 2 files changed, 7 insertions(+)

diff --git a/modules/gatk4/mergevcfs/main.nf b/modules/gatk4/mergevcfs/main.nf
index 964c1a3b..35930a6e 100644
--- a/modules/gatk4/mergevcfs/main.nf
+++ b/modules/gatk4/mergevcfs/main.nf
@@ -13,6 +13,7 @@ process GATK4_MERGEVCFS {
 
     output:
     tuple val(meta), path('*.vcf.gz'), emit: vcf
+    tuple val(meta), path("*.tbi")   , emit: tbi
     path  "versions.yml"             , emit: versions
 
     when:
diff --git a/modules/gatk4/mergevcfs/meta.yml b/modules/gatk4/mergevcfs/meta.yml
index 8d4123d9..6110e944 100644
--- a/modules/gatk4/mergevcfs/meta.yml
+++ b/modules/gatk4/mergevcfs/meta.yml
@@ -35,6 +35,12 @@ output:
       type: file
       description: merged vcf file
       pattern: "*.vcf.gz"
+  - tbi:
+      type: file
+      description: index files for the merged vcf files
+      pattern: "*.tbi"
+
+
   - versions:
       type: file
       description: File containing software versions

From 3e20ca7e9a0400b3d878e6c846a3b3733bfb867c Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Tue, 31 May 2022 15:46:28 +0200
Subject: [PATCH 27/31] Don't hardcode forced output names

---
 tests/modules/filtlong/nextflow.config | 1 +
 tests/modules/filtlong/test.yml        | 6 +++---
 2 files changed, 4 insertions(+), 3 deletions(-)

diff --git a/tests/modules/filtlong/nextflow.config b/tests/modules/filtlong/nextflow.config
index ec9854c2..f0b90e67 100644
--- a/tests/modules/filtlong/nextflow.config
+++ b/tests/modules/filtlong/nextflow.config
@@ -3,5 +3,6 @@ process {
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
 
     ext.args = "--min_length 10"
+    ext.prefix = "${meta.id}_lr"
 
 }
diff --git a/tests/modules/filtlong/test.yml b/tests/modules/filtlong/test.yml
index 93f847ec..87bd491b 100644
--- a/tests/modules/filtlong/test.yml
+++ b/tests/modules/filtlong/test.yml
@@ -3,7 +3,7 @@
   tags:
     - filtlong
   files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
+    - path: output/filtlong/test_lr.fastq.gz
       contains:
         - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
 
@@ -12,7 +12,7 @@
   tags:
     - filtlong
   files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
+    - path: output/filtlong/test_lr.fastq.gz
       contains:
         - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
 
@@ -21,6 +21,6 @@
   tags:
     - filtlong
   files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
+    - path: output/filtlong/test_lr.fastq.gz
       contains:
         - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"

From 089f761f0bf79c4a486f1df9b6205f650196a2c1 Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Tue, 31 May 2022 15:49:57 +0200
Subject: [PATCH 28/31] Actually add the changes

---
 modules/filtlong/main.nf | 5 +++--
 1 file changed, 3 insertions(+), 2 deletions(-)

diff --git a/modules/filtlong/main.nf b/modules/filtlong/main.nf
index 67500053..9dbf05b2 100644
--- a/modules/filtlong/main.nf
+++ b/modules/filtlong/main.nf
@@ -11,7 +11,7 @@ process FILTLONG {
     tuple val(meta), path(shortreads), path(longreads)
 
     output:
-    tuple val(meta), path("${meta.id}_lr_filtlong.fastq.gz"), emit: reads
+    tuple val(meta), path("*.fastq.gz"), emit: reads
     path "versions.yml"                                     , emit: versions
 
     when:
@@ -21,12 +21,13 @@ process FILTLONG {
     def args = task.ext.args ?: ''
     def prefix = task.ext.prefix ?: "${meta.id}"
     def short_reads = !shortreads ? "" : meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
+    if ("$longreads" == "${prefix}.fastq.gz") error "Longread FASTQ input and output names are the same, set prefix in module configuration to disambiguate!"
     """
     filtlong \\
         $short_reads \\
         $args \\
         $longreads \\
-        | gzip -n > ${prefix}_lr_filtlong.fastq.gz
+        | gzip -n > ${prefix}.fastq.gz
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

From 98bb45cf4e93801116d9435f2c1e644f91f0628d Mon Sep 17 00:00:00 2001
From: asp8200 <aspe@clin.au.dk>
Date: Tue, 31 May 2022 13:59:56 +0000
Subject: [PATCH 29/31] Updating test for gatk4/mergevcfs

---
 tests/modules/gatk4/mergevcfs/test.yml | 2 ++
 1 file changed, 2 insertions(+)

diff --git a/tests/modules/gatk4/mergevcfs/test.yml b/tests/modules/gatk4/mergevcfs/test.yml
index da2f7578..eb43a184 100644
--- a/tests/modules/gatk4/mergevcfs/test.yml
+++ b/tests/modules/gatk4/mergevcfs/test.yml
@@ -6,6 +6,8 @@
   files:
     - path: output/gatk4/test.vcf.gz
       md5sum: 5b289bda88d3a3504f2e19ee8cff177c
+    - path: output/gatk4/test.vcf.gz.tbi
+      md5sum: a81673763b13086cfce9a23e72a35a16
     - path: output/gatk4/versions.yml
 
 - name: gatk4 mergevcfs test_gatk4_mergevcfs_no_dict

From 4199a05aeb0ec277d40cb112949bb85893310873 Mon Sep 17 00:00:00 2001
From: asp8200 <aspe@clin.au.dk>
Date: Tue, 31 May 2022 15:34:34 +0000
Subject: [PATCH 30/31] Removing redundant empty line

---
 modules/gatk4/mergevcfs/meta.yml | 1 -
 1 file changed, 1 deletion(-)

diff --git a/modules/gatk4/mergevcfs/meta.yml b/modules/gatk4/mergevcfs/meta.yml
index 6110e944..3ebce0b9 100644
--- a/modules/gatk4/mergevcfs/meta.yml
+++ b/modules/gatk4/mergevcfs/meta.yml
@@ -40,7 +40,6 @@ output:
       description: index files for the merged vcf files
       pattern: "*.tbi"
 
-
   - versions:
       type: file
       description: File containing software versions

From df22cd80df8bee4d3f1d5750026c26c560be7392 Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Tue, 31 May 2022 20:07:52 +0200
Subject: [PATCH 31/31] Fix config for tests

---
 tests/modules/filtlong/nextflow.config | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/tests/modules/filtlong/nextflow.config b/tests/modules/filtlong/nextflow.config
index f0b90e67..5e4c9fbb 100644
--- a/tests/modules/filtlong/nextflow.config
+++ b/tests/modules/filtlong/nextflow.config
@@ -3,6 +3,6 @@ process {
     publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
 
     ext.args = "--min_length 10"
-    ext.prefix = "${meta.id}_lr"
+    ext.prefix = "test_lr"
 
 }