diff --git a/.github/filters.yml b/.github/filters.yml index a8402739..32ce12a7 100644 --- a/.github/filters.yml +++ b/.github/filters.yml @@ -140,6 +140,10 @@ gatk4_samtofastq: - software/gatk4/samtofastq/** - tests/software/gatk4/samtofastq/** +gatk4_splitncigarreads: + - software/gatk4/splitncigarreads/** + - tests/software/gatk4/splitncigarreads/** + gffread: - software/gffread/** - tests/software/gffread/** diff --git a/software/gatk4/splitncigarreads/functions.nf b/software/gatk4/splitncigarreads/functions.nf new file mode 100644 index 00000000..d25eea86 --- /dev/null +++ b/software/gatk4/splitncigarreads/functions.nf @@ -0,0 +1,59 @@ +/* + * ----------------------------------------------------- + * Utility functions used in nf-core DSL2 module files + * ----------------------------------------------------- + */ + +/* + * Extract name of software tool from process name using $task.process + */ +def getSoftwareName(task_process) { + return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase() +} + +/* + * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules + */ +def initOptions(Map args) { + def Map options = [:] + options.args = args.args ?: '' + options.args2 = args.args2 ?: '' + options.publish_by_id = args.publish_by_id ?: false + options.publish_dir = args.publish_dir ?: '' + options.publish_files = args.publish_files + options.suffix = args.suffix ?: '' + return options +} + +/* + * Tidy up and join elements of a list to return a path string + */ +def getPathFromList(path_list) { + def paths = path_list.findAll { item -> !item?.trim().isEmpty() } // Remove empty entries + paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", "") } // Trim whitespace and trailing slashes + return paths.join('/') +} + +/* + * Function to save/publish module results + */ +def saveFiles(Map args) { + if (!args.filename.endsWith('.version.txt')) { + def ioptions = initOptions(args.options) + def path_list = [ ioptions.publish_dir ?: args.publish_dir ] + if (ioptions.publish_by_id) { + path_list.add(args.publish_id) + } + if (ioptions.publish_files instanceof Map) { + for (ext in ioptions.publish_files) { + if (args.filename.endsWith(ext.key)) { + def ext_list = path_list.collect() + ext_list.add(ext.value) + return "${getPathFromList(ext_list)}/$args.filename" + } + } + } else if (ioptions.publish_files == null) { + return "${getPathFromList(path_list)}/$args.filename" + } + } +} diff --git a/software/gatk4/splitncigarreads/main.nf b/software/gatk4/splitncigarreads/main.nf new file mode 100644 index 00000000..0d7e0aa7 --- /dev/null +++ b/software/gatk4/splitncigarreads/main.nf @@ -0,0 +1,41 @@ +// Import generic module functions +include { initOptions; saveFiles; getSoftwareName } from './functions' + +params.options = [:] +def options = initOptions(params.options) + +process GATK4_SPLITNCIGARREADS { + tag "$meta.id" + label 'process_medium' + publishDir "${params.outdir}", + mode: params.publish_dir_mode, + saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) } + + conda (params.enable_conda ? 'bioconda::gatk4:4.1.9.0' : null) + if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) { + container 'https://depot.galaxyproject.org/singularity/gatk4:4.1.9.0--py39_0' + } else { + container 'quay.io/biocontainers/gatk4:4.1.9.0--py39_0' + } + + input: + tuple val(meta), path(bam) + tuple path(fasta), path(fai), path(dict) + + output: + tuple val(meta), path('*.split_cigar.bam'), emit: bam + path '*.version.txt' , emit: version + + script: + def software = getSoftwareName(task.process) + def prefix = options.suffix ? "${meta.id}.${options.suffix}" : "${meta.id}" + """ + gatk SplitNCigarReads \\ + -R $fasta \\ + -I $bam \\ + -O ${prefix}.split_cigar.bam \\ + $options.args + + gatk --version | grep Picard | sed "s/Picard Version: //g" > ${software}.version.txt + """ +} diff --git a/software/gatk4/splitncigarreads/meta.yml b/software/gatk4/splitncigarreads/meta.yml new file mode 100644 index 00000000..33610180 --- /dev/null +++ b/software/gatk4/splitncigarreads/meta.yml @@ -0,0 +1,61 @@ +name: gatk4_splitncigarreads +description: Splits reads that contain Ns in their cigar string +keywords: + - vcf + - merge +tools: + - gatk4: + description: | + Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools + with a primary focus on variant discovery and genotyping. Its powerful processing engine + and high-performance computing features make it capable of taking on projects of any size. + homepage: https://gatk.broadinstitute.org/hc/en-us + documentation: https://gatk.broadinstitute.org/hc/en-us/categories/360002369672s + doi: 10.1158/1538-7445.AM2017-3590 +params: + - outdir: + type: string + description: | + The pipeline's output directory. By default, the module will + output files into `$params.outdir/` + - publish_dir_mode: + type: string + description: | + Value for the Nextflow `publishDir` mode parameter. + Available: symlink, rellink, link, copy, copyNoFollow, move. + - enable_conda: + type: boolean + description: | + Run the module with Conda using the software specified + via the `conda` directive + - singularity_pull_docker_container: + type: boolean + description: | + Instead of directly downloading Singularity images for use with Singularity, + force the workflow to pull and convert Docker containers instead. +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test'] + - bam: + type: list + description: BAM/SAM/CRAM file containing reads + pattern: "*.{bam,sam,cram}" + - fasta: + type: tuple of files + description: | + Tuple of fasta file (first), sequence dict (second) and fasta index (third) + pattern: ["*.fasta", "*.dict", "*.fai"] +output: + - bam: + type: file + description: Output file with split reads (BAM/SAM/CRAM) + pattern: "*.{bam,sam,cram}" + - version: + type: file + description: File containing software version + pattern: "*.version.txt" +authors: + - "@kevinmenden" diff --git a/tests/data/bam/sarscov2_aln.bam b/tests/data/bam/sarscov2_aln.bam new file mode 100644 index 00000000..c24e367a Binary files /dev/null and b/tests/data/bam/sarscov2_aln.bam differ diff --git a/tests/data/fasta/sarscov2/GCA_011545545.1_ASM1154554v1_genomic.fna.fai b/tests/data/fasta/sarscov2/GCA_011545545.1_ASM1154554v1_genomic.fna.fai new file mode 100644 index 00000000..f683583d --- /dev/null +++ b/tests/data/fasta/sarscov2/GCA_011545545.1_ASM1154554v1_genomic.fna.fai @@ -0,0 +1 @@ +MT192765.1 29829 120 80 81 diff --git a/tests/data/fastq/dna/sarscov2_1.fastq.gz b/tests/data/fastq/dna/sarscov2_1.fastq.gz new file mode 100644 index 00000000..d43f1d99 --- /dev/null +++ b/tests/data/fastq/dna/sarscov2_1.fastq.gz @@ -0,0 +1,400 @@ +@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1 +TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT ++ +AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE