Merge pull request #134 from JoseEspinosa/bcftools_viralrecon

Bcftools viralrecon

.github/filters.yml

@@ -2,6 +2,30 @@ bandage_image:
   - software/bandage/image/**
   - tests/software/bandage/image/**
 
+bcftools_bgzip:
+  - software/bcftools/bgzip/**
+  - tests/software/bcftools/bgzip**
+
+bcftools_consensus:
+  - software/bcftools/consensus/**
+  - tests/software/bcftools/consensus**
+
+bcftools_filter:
+  - software/bcftools/filter/**
+  - tests/software/bcftools/filter**
+
+bcftools_isec:
+  - software/bcftools/isec/**
+  - tests/software/bcftools/isec**
+
+bcftools_stats:
+  - software/bcftools/stats/**
+  - tests/software/bcftools/stats**
+
+bcftools_tabix:
+  - software/bcftools/tabix/**
+  - tests/software/bcftools/tabix**
+
 bedtools_complement:
   - software/bedtools/complement/**
   - tests/software/bedtools/complement/**

software/bcftools/bgzip/functions.nf

@@ -0,0 +1,60 @@
+
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", '') } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/bcftools/bgzip/main.nf

@@ -0,0 +1,34 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+def options    = initOptions(params.options)
+
+process BCFTOOLS_BGZIP {
+    tag "$meta.id"
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) }
+
+    conda (params.enable_conda ? "bioconda::bcftools=1.11" : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container "https://depot.galaxyproject.org/singularity/bcftools:1.11--h7c999a4_0"
+    } else {
+        container "quay.io/biocontainers/bcftools:1.11--h7c999a4_0"
+    }
+
+    input:
+    tuple val(meta), path(vcf)
+
+    output:
+    tuple val(meta), path("*.gz"), emit: vcf
+    path  "*.version.txt"        , emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    def prefix   = options.suffix ? "${meta.id}${options.suffix}" : "${meta.id}"
+    """
+    bgzip -c $options.args $vcf > ${prefix}.vcf.gz
+    echo \$(bcftools --version 2>&1) | sed 's/^.*bcftools //; s/ .*\$//' > ${software}.version.txt
+    """
+}

software/bcftools/bgzip/meta.yml

@@ -0,0 +1,60 @@
+name: bcftools_bgzip
+description: Compresses VCF files
+keywords:
+    - variant calling
+    - compress
+    - VCF
+tools:
+    - bgzip:
+        description: |
+          Bgzip compresses files in a similar manner to, and compatible with, gzip.
+        homepage: http://samtools.github.io/bcftools/bcftools.html
+        documentation: http://www.htslib.org/doc/bgzip.html
+        doi: 10.1093/bioinformatics/btp352
+params:
+    - outdir:
+        type: string
+        description: |
+          The pipeline's output directory. By default, the module will
+          output files into `$params.outdir/<SOFTWARE>`
+    - publish_dir_mode:
+        type: string
+        description: |
+          Value for the Nextflow `publishDir` mode parameter.
+          Available: symlink, rellink, link, copy, copyNoFollow, move.
+    - enable_conda:
+        type: boolean
+        description: |
+          Run the module with Conda using the software specified
+          via the `conda` directive
+    - singularity_pull_docker_container:
+        type: boolean
+        description: |
+          Instead of directly downloading Singularity images for use with Singularity,
+          force the workflow to pull and convert Docker containers instead.
+input:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcf:
+        type: file
+        description: VCF text file
+output:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcf:
+        type: file
+        description: Output compressed VCF file
+        pattern: "*.{vcf}"
+    - version:
+        type: file
+        description: File containing software version
+        pattern: "*.{version.txt}"
+authors:
+    - "@joseespinosa"
+    - "@drpatelh"

software/bcftools/consensus/functions.nf

@@ -0,0 +1,60 @@
+
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", '') } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/bcftools/consensus/main.nf

@@ -0,0 +1,37 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+def options    = initOptions(params.options)
+
+process BCFTOOLS_CONSENSUS {
+    tag "$meta.id"
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) }
+
+    conda (params.enable_conda ? "bioconda::bcftools=1.11" : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container "https://depot.galaxyproject.org/singularity/bcftools:1.11--h7c999a4_0"
+    } else {
+        container "quay.io/biocontainers/bcftools:1.11--h7c999a4_0"
+    }
+
+    input:
+    tuple val(meta), path(vcf), path(tbi), path(fasta)
+
+    output:
+    tuple val(meta), path("*.fa"), emit: fasta
+    path  "*.version.txt"        , emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    def prefix   = options.suffix ? "${meta.id}${options.suffix}" : "${meta.id}"
+    """
+    cat $fasta | bcftools consensus $vcf $options.args > ${prefix}.fa
+    header=\$(head -n 1 ${prefix}.fa | sed 's/>//g')
+    sed -i "s/\${header}/${meta.id}/g" ${prefix}.fa
+
+    echo \$(bcftools --version 2>&1) | sed 's/^.*bcftools //; s/ .*\$//' > ${software}.version.txt
+    """
+}

software/bcftools/consensus/meta.yml

@@ -0,0 +1,69 @@
+name: bcftools_consensus
+description: Compresses VCF files
+keywords:
+    - variant calling
+    - consensus
+    - VCF
+tools:
+    - consensus:
+        description: |
+          Create consensus sequence by applying VCF variants to a reference fasta file.
+        homepage: http://samtools.github.io/bcftools/bcftools.html
+        documentation: http://www.htslib.org/doc/bcftools.html
+        doi: 10.1093/bioinformatics/btp352
+params:
+    - outdir:
+        type: string
+        description: |
+          The pipeline's output directory. By default, the module will
+          output files into `$params.outdir/<SOFTWARE>`
+    - publish_dir_mode:
+        type: string
+        description: |
+          Value for the Nextflow `publishDir` mode parameter.
+          Available: symlink, rellink, link, copy, copyNoFollow, move.
+    - enable_conda:
+        type: boolean
+        description: |
+          Run the module with Conda using the software specified
+          via the `conda` directive
+    - singularity_pull_docker_container:
+        type: boolean
+        description: |
+          Instead of directly downloading Singularity images for use with Singularity,
+          force the workflow to pull and convert Docker containers instead.
+input:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcf:
+        type: file
+        description: VCF file
+        pattern: "*.{vcf}"
+    - tbi:
+        type: file
+        description: tabix index file
+        pattern: "*.{tbi}"
+    - fasta:
+        type: file
+        description: FASTA reference file
+        pattern: "*.{fasta,fa}"
+output:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - fasta:
+        type: file
+        description: FASTA reference consensus file
+        pattern: "*.{fasta,fa}"
+    - version:
+        type: file
+        description: File containing software version
+        pattern: "*.{version.txt}"
+authors:
+    - "@joseespinosa"
+    - "@drpatelh"

software/bcftools/filter/functions.nf

@@ -0,0 +1,60 @@
+
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", '') } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/bcftools/filter/main.nf

@@ -0,0 +1,38 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+def options    = initOptions(params.options)
+
+process BCFTOOLS_FILTER {
+    tag "$meta.id"
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) }
+
+    conda (params.enable_conda ? "bioconda::bcftools=1.11" : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container "https://depot.galaxyproject.org/singularity/bcftools:1.11--h7c999a4_0"
+    } else {
+        container "quay.io/biocontainers/bcftools:1.11--h7c999a4_0"
+    }
+
+    input:
+    tuple val(meta), path(vcf)
+
+    output:
+    tuple val(meta), path("*.gz"), emit: vcf
+    path  "*.version.txt"        , emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    def prefix   = options.suffix ? "${meta.id}${options.suffix}" : "${meta.id}"
+    """
+    bcftools filter \\
+        --output ${prefix}.vcf.gz \\
+        $options.args \\
+        $vcf
+
+    echo \$(bcftools --version 2>&1) | sed 's/^.*bcftools //; s/ .*\$//' > ${software}.version.txt
+    """
+}

software/bcftools/filter/meta.yml

@@ -0,0 +1,61 @@
+name: bcftools_filter
+description: Filters VCF files
+keywords:
+    - variant calling
+    - filtering
+    - VCF
+tools:
+    - filter:
+        description: |
+          Apply fixed-threshold filters to VCF files.
+        homepage: http://samtools.github.io/bcftools/bcftools.html
+        documentation: http://www.htslib.org/doc/bcftools.html
+        doi: 10.1093/bioinformatics/btp352
+params:
+    - outdir:
+        type: string
+        description: |
+          The pipeline's output directory. By default, the module will
+          output files into `$params.outdir/<SOFTWARE>`
+    - publish_dir_mode:
+        type: string
+        description: |
+          Value for the Nextflow `publishDir` mode parameter.
+          Available: symlink, rellink, link, copy, copyNoFollow, move.
+    - enable_conda:
+        type: boolean
+        description: |
+          Run the module with Conda using the software specified
+          via the `conda` directive
+    - singularity_pull_docker_container:
+        type: boolean
+        description: |
+          Instead of directly downloading Singularity images for use with Singularity,
+          force the workflow to pull and convert Docker containers instead.
+input:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcf:
+        type: file
+        description: VCF input file
+        pattern: "*.{vcf}"
+output:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcf:
+        type: file
+        description: VCF filtered output file
+        pattern: "*.{vcf}"
+    - version:
+        type: file
+        description: File containing software version
+        pattern: "*.{version.txt}"
+authors:
+    - "@joseespinosa"
+    - "@drpatelh"

software/bcftools/isec/functions.nf

@@ -0,0 +1,60 @@
+
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", '') } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/bcftools/isec/main.nf

@@ -0,0 +1,37 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+def options    = initOptions(params.options)
+
+process BCFTOOLS_ISEC {
+    tag "$meta.id"
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) }
+
+    conda (params.enable_conda ? "bioconda::bcftools=1.11" : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container "https://depot.galaxyproject.org/singularity/bcftools:1.11--h7c999a4_0"
+    } else {
+        container "quay.io/biocontainers/bcftools:1.11--h7c999a4_0"
+    }
+
+    input:
+    tuple val(meta), path(vcfs), path(tbis)
+
+    output:
+    tuple val(meta), path("${prefix}"), emit: results
+    path  "*.version.txt"             , emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    prefix       = options.suffix ? "${meta.id}${options.suffix}" : "${meta.id}"
+    """
+    bcftools isec  \\
+        $options.args \\
+        -p $prefix \\
+        *.vcf.gz
+    echo \$(bcftools --version 2>&1) | sed 's/^.*bcftools //; s/ .*\$//' > ${software}.version.txt
+    """
+}

software/bcftools/isec/meta.yml

@@ -0,0 +1,69 @@
+name: bcftools_isec
+description: Apply set operations to VCF files
+keywords:
+    - variant calling
+    - intersect
+    - union
+    - complement
+    - VCF
+tools:
+    - isec:
+        description: |
+          Computes intersections, unions and complements of VCF files.
+        homepage: http://samtools.github.io/bcftools/bcftools.html
+        documentation: http://www.htslib.org/doc/bcftools.html
+        doi: 10.1093/bioinformatics/btp352
+params:
+    - outdir:
+        type: string
+        description: |
+          The pipeline's output directory. By default, the module will
+          output files into `$params.outdir/<SOFTWARE>`
+    - publish_dir_mode:
+        type: string
+        description: |
+          Value for the Nextflow `publishDir` mode parameter.
+          Available: symlink, rellink, link, copy, copyNoFollow, move.
+    - enable_conda:
+        type: boolean
+        description: |
+          Run the module with Conda using the software specified
+          via the `conda` directive
+    - singularity_pull_docker_container:
+        type: boolean
+        description: |
+          Instead of directly downloading Singularity images for use with Singularity,
+          force the workflow to pull and convert Docker containers instead.
+input:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcfs:
+        type: files
+        description: |
+          List containing 2 or more vcf files
+          e.g. [ 'file1.vcf', 'file2.vcf' ]
+    - tbis:
+        type: files
+        description: |
+          List containing the tbi index files corresponding to the vcfs input files
+          e.g. [ 'file1.vcf.tbi', 'file2.vcf.tbi' ]
+output:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - results:
+        type: directory
+        description: Folder containing the set operations results perform on the vcf files
+        pattern: "${prefix}"
+    - version:
+        type: file
+        description: File containing software version
+        pattern: "*.{version.txt}"
+authors:
+    - "@joseespinosa"
+    - "@drpatelh"

software/bcftools/stats/functions.nf

@@ -0,0 +1,60 @@
+
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", '') } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/bcftools/stats/main.nf

@@ -0,0 +1,34 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+def options    = initOptions(params.options)
+
+process BCFTOOLS_STATS {
+    tag "$meta.id"
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) }
+
+    conda (params.enable_conda ? "bioconda::bcftools=1.11" : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container "https://depot.galaxyproject.org/singularity/bcftools:1.11--h7c999a4_0"
+    } else {
+        container "quay.io/biocontainers/bcftools:1.11--h7c999a4_0"
+    }
+
+    input:
+    tuple val(meta), path(vcf)
+
+    output:
+    tuple val(meta), path("*.txt"), emit: stats
+    path  "*.version.txt"         , emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    def prefix   = options.suffix ? "${meta.id}${options.suffix}" : "${meta.id}"
+    """
+    bcftools stats $options.args $vcf > ${prefix}.bcftools_stats.txt
+    echo \$(bcftools --version 2>&1) | sed 's/^.*bcftools //; s/ .*\$//' > ${software}.version.txt
+    """
+}

software/bcftools/stats/meta.yml

@@ -0,0 +1,62 @@
+name: bcftools_stats
+description: Generates stats from VCF files
+keywords:
+    - variant calling
+    - stats
+    - VCF
+tools:
+    - stats:
+        description: |
+          Parses VCF or BCF and produces text file stats which is suitable for
+          machine processing and can be plotted using plot-vcfstats.
+        homepage: http://samtools.github.io/bcftools/bcftools.html
+        documentation: http://www.htslib.org/doc/bcftools.html
+        doi: 10.1093/bioinformatics/btp352
+params:
+    - outdir:
+        type: string
+        description: |
+          The pipeline's output directory. By default, the module will
+          output files into `$params.outdir/<SOFTWARE>`
+    - publish_dir_mode:
+        type: string
+        description: |
+          Value for the Nextflow `publishDir` mode parameter.
+          Available: symlink, rellink, link, copy, copyNoFollow, move.
+    - enable_conda:
+        type: boolean
+        description: |
+          Run the module with Conda using the software specified
+          via the `conda` directive
+    - singularity_pull_docker_container:
+        type: boolean
+        description: |
+          Instead of directly downloading Singularity images for use with Singularity,
+          force the workflow to pull and convert Docker containers instead.
+input:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcf:
+        type: file
+        description: VCF input file
+        pattern: "*.{vcf}"
+output:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - stats:
+        type: file
+        description: Text output file containing stats
+        pattern: "*.{txt}"
+    - version:
+        type: file
+        description: File containing software version
+        pattern: "*.{version.txt}"
+authors:
+    - "@joseespinosa"
+    - "@drpatelh"

software/bcftools/tabix/functions.nf

@@ -0,0 +1,60 @@
+
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", '') } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/bcftools/tabix/main.nf

@@ -0,0 +1,33 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+def options    = initOptions(params.options)
+
+process BCFTOOLS_TABIX {
+    tag "$meta.id"
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) }
+
+    conda (params.enable_conda ? "bioconda::bcftools=1.11" : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container "https://depot.galaxyproject.org/singularity/bcftools:1.11--h7c999a4_0"
+    } else {
+        container "quay.io/biocontainers/bcftools:1.11--h7c999a4_0"
+    }
+
+    input:
+    tuple val(meta), path(vcf)
+
+    output:
+    tuple val(meta), path("*.tbi"), emit: tbi
+    path  "*.version.txt"         , emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    """
+    tabix $options.args $vcf
+    echo \$(bcftools --version 2>&1) | sed 's/^.*bcftools //; s/ .*\$//' > ${software}.version.txt
+    """
+}

software/bcftools/tabix/meta.yml

@@ -0,0 +1,63 @@
+name: bcftools_tabix
+description: Index GFF/BED/SAM/VCF file
+keywords:
+    - index
+    - vcf
+    - bed
+    - sam
+    - gff
+tools:
+    - stats:
+        description: |
+          Indexes a TAB-delimited genome position file.
+        homepage: http://samtools.github.io/bcftools/bcftools.html
+        documentation: http://www.htslib.org/doc/bcftools.html
+        doi: 10.1093/bioinformatics/btp352
+params:
+    - outdir:
+        type: string
+        description: |
+          The pipeline's output directory. By default, the module will
+          output files into `$params.outdir/<SOFTWARE>`
+    - publish_dir_mode:
+        type: string
+        description: |
+          Value for the Nextflow `publishDir` mode parameter.
+          Available: symlink, rellink, link, copy, copyNoFollow, move.
+    - enable_conda:
+        type: boolean
+        description: |
+          Run the module with Conda using the software specified
+          via the `conda` directive
+    - singularity_pull_docker_container:
+        type: boolean
+        description: |
+          Instead of directly downloading Singularity images for use with Singularity,
+          force the workflow to pull and convert Docker containers instead.
+input:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - vcf:
+        type: file
+        description: TAB-delimited genome position file compressed with bgzip
+        pattern: "*.{vcf.gz,bed.gz,sam.gz,gff.gz}"
+output:
+    - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. [ id:'test', single_end:false ]
+    - tbi:
+        type: file
+        description:  Index file
+        pattern: "*.{tbi}"
+    - version:
+        type: file
+        description: File containing software version
+        pattern: "*.{version.txt}"
+authors:
+    - "@joseespinosa"
+    - "@drpatelh"

tests/data/vcf/test.consensus.fa

@@ -0,0 +1,20 @@
+>1:2-501
+TACcAtATgTgACAtATAAaAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTG
+cAGAAAAGGAAGACTTAAAAAGAGTCAGTACTAACCTACATAATATATACAATGTTCATT
+AAATAATAAAATGAGCTCATCATACTTAGGTCATCATAAATATATCTGAAATTCACAAAT
+ATTGATCAAATGGTAAAATAGACAAGTAGATTTTAATAGGTTAAACAATTACTGATTCTC
+TTGAAAGAATAAATTTAATATGAGACCTATTTCATTATAATGAACTCACAAATTAGAAAC
+TTCACACTGGGGGCTGGAGAGATGGCTCAGTAGTTAAGAACACTGACTGCTCTTCTGAAG
+GTCCTGAGTTCAAATCCCAGCAACCACATGGTGACTTACAACCATCTGTAATGACATCTG
+ATGCCCTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATAAAATAATAAATAAATC
+TTTAAAAACAAAAAAAAAGAA
+>2
+gaagatcttttccttattaaggatctgaagctctgtagatttgtattctattaaacatgg
+AgagattagtgattttccatattctttaagtcattttagagtaatgtgttcttaagatAa
+atcagaaaaacaaaaacttgtgctttcctgtttgaaaaacaaacagctgtggggaatgGt
+gtcgggacagcctttttatAaaatttttctaaataatgttgaggctttgatacgtcaaag
+ttatatttcaaatggaatcacttagacctcgtttctgagtgtcaatggccatattggggA
+tttgctgctgccaatgacaGcacaccctgggaatgccccaactacttactacaaagcagt
+gttacatggagaagatcttcaagagtctttttgctagatctttccttggcttttgatgtg
+actcctctcaataaaatccacagtaatatagtgagtggtctcctgctccaaaccagtatt
+Tcagacacagttaatccagac

tests/data/vcf/test.vcf

@@ -0,0 +1,24 @@
+##fileformat=VCFv4.2
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##reference=file://some/path/human_g1k_v37.fasta
+##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record">
+##INFO=<ID=MinDP,Number=1,Type=Integer,Description="Dummy">
+##ALT=<ID=DEL,Description="Deletion">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	NA001
+1	5	.	C	A	.	PASS	.	GT	0/1
+1	5	.	C	T	.	PASS	.	GT	0/1
+1	7	.	T	A	.	PASS	.	GT	.
+1	10	.	G	A	.	PASS	.	GT	0/1
+1	12	.	GACA	GA	.	PASS	.	GT	0/1
+1	16	.	T	TAAA	.	PASS	.	GT	1/1
+1	19	.	A	C	.	PASS	.	GT	0/1
+1	61	.	C	A	.	PASS	.	GT	0/1
+2	61	.	agag	aa	.	PASS	.	GT	0/1
+2	119	.	aaa	t	.	PASS	.	GT	0/1
+2	179	.	g	gacgtacgt	.	PASS	.	GT	0/1
+2	200	.	a	<DEL>	.	PASS	END=210	GT	1/0
+2	300	.	a	.	.	PASS	END=310;MinDP=10	GT	0/1
+2	320	.	a	<*>	.	PASS	END=330;MinDP=20	GT	0/1
+2	481	.	t	c,a	.	PASS	.	GT	0/2

tests/software/bcftools/bgzip/main.nf

@@ -0,0 +1,14 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { BCFTOOLS_BGZIP } from '../../../../software/bcftools/bgzip/main.nf' addParams( options: [:] )
+
+workflow test_bcftools_bgzip {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf", checkIfExists: true) ]]
+
+    BCFTOOLS_BGZIP ( input )
+}

tests/software/bcftools/bgzip/test.yml

@@ -0,0 +1,8 @@
+- name: bcftools bgzip
+  command: nextflow run ./tests/software/bcftools/bgzip -entry test_bcftools_bgzip -c tests/config/nextflow.config
+  tags:
+    - bcftools
+    - bcftools_bgzip
+  files:
+    - path: output/bcftools/test.vcf.gz
+      md5sum: eb75ae1f08a1884f8edc59ed423471a2

tests/software/bcftools/consensus/main.nf

@@ -0,0 +1,16 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { BCFTOOLS_CONSENSUS } from '../../../../software/bcftools/consensus/main.nf' addParams( options: [:] )
+
+workflow test_bcftools_consensus {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf.gz", checkIfExists: true) ],
+              [ file("${launchDir}/tests/data/vcf/test.vcf.gz.tbi", checkIfExists: true) ],
+              [ file("${launchDir}/tests/data/vcf/test.consensus.fa", checkIfExists: true) ] ]
+
+    BCFTOOLS_CONSENSUS ( input )
+}

tests/software/bcftools/consensus/test.yml

@@ -0,0 +1,8 @@
+- name: bcftools consensus
+  command: nextflow run ./tests/software/bcftools/consensus -entry test_bcftools_consensus -c tests/config/nextflow.config
+  tags:
+    - bcftools
+    - bcftools_consensus
+  files:
+    - path: output/bcftools/test.fa
+      md5sum: c9e7ac4537756a0b33bcf17117f9a065

tests/software/bcftools/filter/main.nf

@@ -0,0 +1,15 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+//keep --no-verson argument, otherwise md5 will change on each execution
+include { BCFTOOLS_FILTER } from '../../../../software/bcftools/filter/main.nf' addParams( options: ['args': '--no-version'] )
+
+workflow test_bcftools_filter {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf", checkIfExists: true) ]]
+
+    BCFTOOLS_FILTER ( input )
+}

tests/software/bcftools/filter/test.yml

@@ -0,0 +1,8 @@
+- name: bcftools filter
+  command: nextflow run ./tests/software/bcftools/filter -entry test_bcftools_filter -c tests/config/nextflow.config
+  tags:
+    - bcftools
+    - bcftools_filter
+  files:
+    - path: output/bcftools/test.vcf.gz
+      md5sum: 16947ce72a127938d881113a1e6e696b

tests/software/bcftools/isec/main.nf

@@ -0,0 +1,20 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { BCFTOOLS_ISEC } from '../../../../software/bcftools/isec/main.nf' addParams( options: ['args': '--nfiles +2 --output-type z --no-version'] )
+
+workflow test_bcftools_isec {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf.gz", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test2.vcf.gz", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test3.vcf.gz", checkIfExists: true)],
+              [ file("${launchDir}/tests/data/vcf/test.vcf.gz.tbi", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test2.vcf.gz.tbi", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test3.vcf.gz.tbi", checkIfExists: true) ]]
+
+    BCFTOOLS_ISEC ( input )
+
+}

tests/software/bcftools/isec/test.yml

@@ -0,0 +1,22 @@
+- name: bcftools isec
+  command: nextflow run ./tests/software/bcftools/isec -entry test_bcftools_isec -c tests/config/nextflow.config
+  tags:
+    - bcftools
+    - bcftools_isec
+  files:
+    - path: output/bcftools/test/0000.vcf.gz
+      md5sum: 4e84e3b6903fa44e8bd1acdeff9b265d
+    - path: output/bcftools/test/0000.vcf.gz.tbi
+      md5sum: 8484b151ef902e25e54f7713d46ed90e
+    - path: output/bcftools/test/0001.vcf.gz
+      md5sum: 4e84e3b6903fa44e8bd1acdeff9b265d
+    - path: output/bcftools/test/0001.vcf.gz.tbi
+      md5sum: 8484b151ef902e25e54f7713d46ed90e
+    - path: output/bcftools/test/0002.vcf.gz
+      md5sum: 4e84e3b6903fa44e8bd1acdeff9b265d
+    - path: output/bcftools/test/0002.vcf.gz.tbi
+      md5sum: 8484b151ef902e25e54f7713d46ed90e
+    - path: output/bcftools/test/README.txt
+      md5sum: 63ef64134d2685bc5d50332ef20389d2
+    - path: output/bcftools/test/sites.txt
+      md5sum: 01bb949ed7825ecf692bf0640e363647

tests/software/bcftools/stats/main.nf

@@ -0,0 +1,14 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { BCFTOOLS_STATS } from '../../../../software/bcftools/stats/main.nf' addParams( options: [:] )
+
+workflow test_bcftools_stats {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf", checkIfExists: true) ]]
+
+    BCFTOOLS_STATS ( input )
+}

tests/software/bcftools/stats/test.yml

@@ -0,0 +1,8 @@
+- name: bcftools stats
+  command: nextflow run ./tests/software/bcftools/stats -entry test_bcftools_stats -c tests/config/nextflow.config
+  tags:
+    - bcftools
+    - bcftools_stats
+  files:
+    - path: output/bcftools/test.bcftools_stats.txt
+      md5sum: abfc6a90f84e24b2cc7e92cbce06200a

tests/software/bcftools/tabix/main.nf

@@ -0,0 +1,14 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { BCFTOOLS_TABIX } from '../../../../software/bcftools/tabix/main.nf' addParams( options: [:] )
+
+workflow test_bcftools_tabix {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf.gz", checkIfExists: true) ] ]
+
+    BCFTOOLS_TABIX ( input )
+}

tests/software/bcftools/tabix/test.yml

@@ -0,0 +1,8 @@
+- name: bcftools tabix
+  command: nextflow run ./tests/software/bcftools/tabix -entry test_bcftools_tabix -c tests/config/nextflow.config
+  tags:
+    - bcftools
+    - bcftools_tabix
+  files:
+    - path: output/bcftools/test.vcf.gz.tbi
+      md5sum: 06d52177f819730dd409157914534e8d