Merge remote-tracking branch 'origin/master' into cnvkit_bam

This commit is contained in:
SusiJo 2022-06-01 17:35:47 +02:00
commit 9fc9be3e7b
62 changed files with 1401 additions and 246 deletions

View file

@ -42,7 +42,6 @@ output:
type: file type: file
description: File containing software versions description: File containing software versions
pattern: "versions.yml" pattern: "versions.yml"
## TODO nf-core: Delete / customise this example output
- out: - out:
type: file type: file
description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml) description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml)

View file

@ -8,7 +8,7 @@ process BCFTOOLS_CONCAT {
'quay.io/biocontainers/bcftools:1.14--h88f3f91_0' }" 'quay.io/biocontainers/bcftools:1.14--h88f3f91_0' }"
input: input:
tuple val(meta), path(vcfs) tuple val(meta), path(vcfs), path(tbi)
output: output:
tuple val(meta), path("*.gz"), emit: vcf tuple val(meta), path("*.gz"), emit: vcf

View file

@ -25,6 +25,11 @@ input:
description: | description: |
List containing 2 or more vcf files List containing 2 or more vcf files
e.g. [ 'file1.vcf', 'file2.vcf' ] e.g. [ 'file1.vcf', 'file2.vcf' ]
- tbi:
type: files
description: |
List containing 2 or more index files (optional)
e.g. [ 'file1.tbi', 'file2.tbi' ]
output: output:
- meta: - meta:
type: map type: map

View file

@ -0,0 +1,61 @@
process BCFTOOLS_ROH {
tag "$meta.id"
label 'process_medium'
conda (params.enable_conda ? "bioconda::bcftools=1.15.1" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/bcftools:1.15.1--h0ea216a_0':
'quay.io/biocontainers/bcftools:1.15.1--h0ea216a_0' }"
input:
tuple val(meta), path(vcf), path(tbi)
path af_file
path genetic_map
path regions_file
path samples_file
path targets_file
output:
tuple val(meta), path("*.roh"), emit: roh
path "versions.yml" , emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
def af_read = af_file ? "--AF-file ${af_file}" : ''
def gen_map = genetic_map ? "--genetic-map ${genetic_map}" : ''
def reg_file = regions_file ? "--regions-file ${regions_file}" : ''
def samp_file = samples_file ? "--samples-file ${samples_file}" : ''
def targ_file = targets_file ? "--targets-file ${targets_file}" : ''
"""
bcftools \\
roh \\
$args \\
$af_read \\
$gen_map \\
$reg_file \\
$samp_file \\
$targ_file \\
-o ${prefix}.roh \\
$vcf
cat <<-END_VERSIONS > versions.yml
"${task.process}":
bcftools: \$(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*\$//')
END_VERSIONS
"""
stub:
def prefix = task.ext.prefix ?: "${meta.id}"
"""
touch ${prefix}.roh
cat <<-END_VERSIONS > versions.yml
"${task.process}":
bcftools: \$(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*\$//')
END_VERSIONS
"""
}

View file

@ -0,0 +1,55 @@
name: "bcftools_roh"
description: A program for detecting runs of homo/autozygosity. Only bi-allelic sites are considered.
keywords:
- roh
tools:
- "roh":
description: "A program for detecting runs of homo/autozygosity. Only bi-allelic sites are considered."
homepage: https://www.htslib.org/
documentation: http://www.htslib.org/doc/bcftools.html
doi: 10.1093/bioinformatics/btp352
licence: ["MIT"]
input:
- meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- vcf:
type: file
description: VCF file
pattern: "*.{vcf,.vcf.gz}"
- af_file:
type: file
description: "Read allele frequencies from a tab-delimited file containing the columns: CHROM\tPOS\tREF,ALT\tAF."
- genetic_map:
type: file
description: "Genetic map in the format required also by IMPUTE2."
- regions_file:
type: file
description: "Regions can be specified either on command line or in a VCF, BED, or tab-delimited file (the default)."
- samples_file:
type: file
description: "File of sample names to include or exclude if prefixed with '^'."
- targets_file:
type: file
description: "Targets can be specified either on command line or in a VCF, BED, or tab-delimited file (the default)."
output:
- meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
- roh:
type: file
description: Contains site-specific and/or per-region runs of homo/autozygosity calls.
pattern: "*.{roh}"
authors:
- "@ramprasadn"

View file

@ -0,0 +1,40 @@
process CNVKIT_REFERENCE {
tag "$fasta"
label 'process_low'
conda (params.enable_conda ? "bioconda::cnvkit=0.9.9" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/cnvkit:0.9.9--pyhdfd78af_0':
'quay.io/biocontainers/cnvkit:0.9.9--pyhdfd78af_0' }"
input:
path fasta
path targets
path antitargets
output:
path "*.cnn" , emit: cnn
path "versions.yml", emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: targets.BaseName
"""
cnvkit.py \\
reference \\
--fasta $fasta \\
--targets $targets \\
--antitargets $antitargets \\
--output ${prefix}.reference.cnn \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
END_VERSIONS
"""
}

View file

@ -0,0 +1,47 @@
name: cnvkit_reference
description:
keywords:
- cnvkit
- reference
tools:
- cnvkit:
description: |
CNVkit is a Python library and command-line software toolkit to infer and visualize copy number from high-throughput DNA sequencing data.
It is designed for use with hybrid capture, including both whole-exome and custom target panels, and short-read sequencing platforms such as Illumina and Ion Torrent.
homepage: https://cnvkit.readthedocs.io/en/stable/index.html
documentation: https://cnvkit.readthedocs.io/en/stable/index.html
tool_dev_url: https://github.com/etal/cnvkit
doi: 10.1371/journal.pcbi.1004873
licence: ["Apache-2.0"]
input:
- fasta:
type: file
description: File containing reference genome
pattern: "*.{fasta}"
- targets:
type: file
description: File containing genomic regions
pattern: "*.{bed}"
- antitargets:
type: file
description: File containing off-target genomic regions
pattern: "*.{bed}"
output:
- meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- reference:
type: file
description: File containing a copy-number reference (required for CNV calling in tumor_only mode)
pattern: "*.{cnn}"
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
authors:
- "@SusiJo"

View file

@ -11,7 +11,7 @@ process FILTLONG {
tuple val(meta), path(shortreads), path(longreads) tuple val(meta), path(shortreads), path(longreads)
output: output:
tuple val(meta), path("${meta.id}_lr_filtlong.fastq.gz"), emit: reads tuple val(meta), path("*.fastq.gz"), emit: reads
path "versions.yml" , emit: versions path "versions.yml" , emit: versions
when: when:
@ -20,13 +20,14 @@ process FILTLONG {
script: script:
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}" def prefix = task.ext.prefix ?: "${meta.id}"
def short_reads = meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}" def short_reads = !shortreads ? "" : meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
if ("$longreads" == "${prefix}.fastq.gz") error "Longread FASTQ input and output names are the same, set prefix in module configuration to disambiguate!"
""" """
filtlong \\ filtlong \\
$short_reads \\ $short_reads \\
$args \\ $args \\
$longreads \\ $longreads \\
| gzip -n > ${prefix}_lr_filtlong.fastq.gz | gzip -n > ${prefix}.fastq.gz
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":

View file

@ -1,6 +1,6 @@
def VERSION = '2.1' // Version information not provided by tool on CLI def VERSION = '2.1' // Version information not provided by tool on CLI
process GAMMA { process GAMMA_GAMMA {
tag "$meta.id" tag "$meta.id"
label 'process_low' label 'process_low'
@ -26,13 +26,24 @@ process GAMMA {
script: script:
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}" def prefix = task.ext.prefix ?: "${meta.id}"
""" """
GAMMA.py \\ if [[ ${fasta} == *.gz ]]
then
FNAME=\$(basename ${fasta} .gz)
gunzip -f ${fasta}
GAMMA.py \\
$args \\
"\${FNAME}" \\
$db \\
$prefix
else
GAMMA.py \\
$args \\ $args \\
$fasta \\ $fasta \\
$db \\ $db \\
$prefix $prefix
fi
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":
gamma: $VERSION gamma: $VERSION

View file

@ -1,4 +1,4 @@
name: "gamma" name: "gamma_gamma"
description: Gene Allele Mutation Microbial Assessment description: Gene Allele Mutation Microbial Assessment
keywords: keywords:
- gamma - gamma
@ -61,3 +61,4 @@ output:
authors: authors:
- "@sateeshperi" - "@sateeshperi"
- "@rastanton" - "@rastanton"
- "@jvhagey"

View file

@ -0,0 +1,53 @@
process GATK4_COMPOSESTRTABLEFILE {
tag "$fasta"
label 'process_low'
conda (params.enable_conda ? "bioconda::gatk4=4.2.6.1" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/gatk4:4.2.6.1--hdfd78af_0':
'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
input:
path(fasta)
path(fasta_fai)
path(dict)
output:
path "*.zip" , emit: str_table
path "versions.yml" , emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def avail_mem = 6
if (!task.memory) {
log.info '[GATK ComposeSTRTableFile] Available memory not known - defaulting to 6GB. Specify process memory requirements to change this.'
} else {
avail_mem = task.memory.giga
}
"""
gatk --java-options "-Xmx${avail_mem}g" ComposeSTRTableFile \\
--reference $fasta \\
--output ${fasta.baseName}.zip \\
--tmp-dir . \\
$args
cat <<-END_VERSIONS > versions.yml
"${task.process}":
gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
END_VERSIONS
"""
stub:
"""
touch test.zip
cat <<-END_VERSIONS > versions.yml
"${task.process}":
gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
END_VERSIONS
"""
}

View file

@ -0,0 +1,43 @@
name: "gatk4_composestrtablefile"
description: This tool looks for low-complexity STR sequences along the reference that are later used to estimate the Dragstr model during single sample auto calibration CalibrateDragstrModel.
keywords:
- gatk4
- composestrtablefile
tools:
- gatk4:
description:
Genome Analysis Toolkit (GATK4). Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools
with a primary focus on variant discovery and genotyping. Its powerful processing engine
and high-performance computing features make it capable of taking on projects of any size.
homepage: https://gatk.broadinstitute.org/hc/en-us
documentation: https://gatk.broadinstitute.org/hc/en-us/articles/4405451249819-ComposeSTRTableFile
tool_dev_url: https://github.com/broadinstitute/gatk
doi: 10.1158/1538-7445.AM2017-3590
licence: ["Apache-2.0"]
input:
- fasta:
type: file
description: FASTA reference file
pattern: "*.{fasta,fa}"
- fasta_fai:
type: file
description: index of the FASTA reference file
pattern: "*.fai"
- dict:
type: file
description: Sequence dictionary of the FASTA reference file
pattern: "*.dict"
output:
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
- str_table:
type: file
description: A zipped folder containing the STR table files
pattern: "*.zip"
authors:
- "@nvnieuwk"

View file

@ -13,6 +13,7 @@ process GATK4_MERGEVCFS {
output: output:
tuple val(meta), path('*.vcf.gz'), emit: vcf tuple val(meta), path('*.vcf.gz'), emit: vcf
tuple val(meta), path("*.tbi") , emit: tbi
path "versions.yml" , emit: versions path "versions.yml" , emit: versions
when: when:

View file

@ -35,6 +35,11 @@ output:
type: file type: file
description: merged vcf file description: merged vcf file
pattern: "*.vcf.gz" pattern: "*.vcf.gz"
- tbi:
type: file
description: index files for the merged vcf files
pattern: "*.tbi"
- versions: - versions:
type: file type: file
description: File containing software versions description: File containing software versions

42
modules/kat/hist/main.nf Normal file
View file

@ -0,0 +1,42 @@
process KAT_HIST {
tag "$meta.id"
label 'process_medium'
conda (params.enable_conda ? "bioconda::kat=2.4.2" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/kat:2.4.2--py38hfc5f9d8_2':
'quay.io/biocontainers/kat:2.4.2--py38hfc5f9d8_2' }"
input:
tuple val(meta), path(reads)
output:
tuple val(meta), path("*.hist") , emit: hist
tuple val(meta), path("*.hist.dist_analysis.json"), emit: json
tuple val(meta), path("*.png") , emit: png , optional: true
tuple val(meta), path("*.ps") , emit: ps , optional: true
tuple val(meta), path("*.pdf") , emit: pdf , optional: true
tuple val(meta), path("*-hash.jf*") , emit: jellyfish_hash, optional: true
path "versions.yml" , emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
"""
kat hist \\
--threads $task.cpus \\
--output_prefix ${prefix}.hist \\
$args \\
$reads
ls -l
cat <<-END_VERSIONS > versions.yml
"${task.process}":
kat: \$( kat hist --version | sed 's/kat //' )
END_VERSIONS
"""
}

64
modules/kat/hist/meta.yml Normal file
View file

@ -0,0 +1,64 @@
name: "kat_hist"
description: Creates a histogram of the number of distinct k-mers having a given frequency.
keywords:
- k-mer
- histogram
- count
tools:
- "kat":
description: "KAT is a suite of tools that analyse jellyfish hashes or sequence files (fasta or fastq) using kmer counts"
homepage: https://www.earlham.ac.uk/kat-tools
documentation: https://kat.readthedocs.io/en/latest/index.html
tool_dev_url: https://github.com/TGAC/KAT
doi: http://bioinformatics.oxfordjournals.org/content/early/2016/10/20/bioinformatics.btw663.abstract
licence: "['GPL v3']"
input:
- meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- reads:
type: file
description: |
List of input FastQ files of size 1 and 2 for single-end and paired-end data,
respectively.
output:
- meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
- hist:
type: file
description: KAT histogram of k-mer counts
pattern: "*.hist"
- json:
type: file
description: KAT histogram summary of distance analysis
pattern: "*.hist.dist_analysis.json"
- png:
type: file
description: KAT plot of k-mer histogram in PNG format
pattern: "*.png"
- ps:
type: file
description: KAT plot of k-mer histogram in PS format
pattern: "*.ps"
- pdf:
type: file
description: KAT plot of k-mer histogram in PDF format
pattern: "*.pdf"
- jellyfish_hash:
type: file
description: Jellyfish hash file
pattern: "*-hist.jf*"
authors:
- "@mahesh-panchal"

View file

@ -8,8 +8,8 @@ process MASH_SCREEN {
'quay.io/biocontainers/mash:2.3--he348c14_1' }" 'quay.io/biocontainers/mash:2.3--he348c14_1' }"
input: input:
tuple val(meta), path(query_sketch) tuple val(meta), path(query)
path fastx_db path sequences_sketch
output: output:
tuple val(meta), path("*.screen"), emit: screen tuple val(meta), path("*.screen"), emit: screen
@ -26,8 +26,8 @@ process MASH_SCREEN {
screen \\ screen \\
$args \\ $args \\
-p $task.cpus \\ -p $task.cpus \\
$query_sketch \\ $sequences_sketch \\
$fastx_db \\ $query \\
> ${prefix}.screen > ${prefix}.screen
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml

View file

@ -20,13 +20,14 @@ input:
description: | description: |
Groovy Map containing sample information Groovy Map containing sample information
e.g. [ id:'test', single_end:false ] e.g. [ id:'test', single_end:false ]
- query_sketch: - query:
type: file type: file
description: MinHash sketch of query sequences description: Query sequences
pattern: "*.msh" pattern: "*.fastq.gz"
- fastx_db: - sequence_sketch:
type: file type: file
description: Sequence files to match against description: Sequence files to match against
pattern: "*.msh"
output: output:
- meta: - meta:

View file

@ -10,18 +10,22 @@ process MOSDEPTH {
input: input:
tuple val(meta), path(bam), path(bai) tuple val(meta), path(bam), path(bai)
path bed path bed
val window_size path fasta
output: output:
tuple val(meta), path('*.global.dist.txt') , emit: global_txt tuple val(meta), path('*.global.dist.txt') , emit: global_txt
tuple val(meta), path('*.region.dist.txt') , emit: regions_txt , optional:true tuple val(meta), path('*.summary.txt') , emit: summary_txt
tuple val(meta), path('*.summary.txt') , emit: summary_txt tuple val(meta), path('*.region.dist.txt') , optional:true, emit: regions_txt
tuple val(meta), path('*.per-base.d4') , emit: d4 , optional:true tuple val(meta), path('*.per-base.d4') , optional:true, emit: per_base_d4
tuple val(meta), path('*.per-base.bed.gz') , emit: per_base_bed, optional:true tuple val(meta), path('*.per-base.bed.gz') , optional:true, emit: per_base_bed
tuple val(meta), path('*.per-base.bed.gz.csi'), emit: per_base_csi, optional:true tuple val(meta), path('*.per-base.bed.gz.csi') , optional:true, emit: per_base_csi
tuple val(meta), path('*.regions.bed.gz') , emit: regions_bed , optional:true tuple val(meta), path('*.regions.bed.gz') , optional:true, emit: regions_bed
tuple val(meta), path('*.regions.bed.gz.csi') , emit: regions_csi , optional:true tuple val(meta), path('*.regions.bed.gz.csi') , optional:true, emit: regions_csi
path "versions.yml" , emit: versions tuple val(meta), path('*.quantized.bed.gz') , optional:true, emit: quantized_bed
tuple val(meta), path('*.quantized.bed.gz.csi') , optional:true, emit: quantized_csi
tuple val(meta), path('*.thresholds.bed.gz') , optional:true, emit: thresholds_bed
tuple val(meta), path('*.thresholds.bed.gz.csi'), optional:true, emit: thresholds_csi
path "versions.yml" , emit: versions
when: when:
task.ext.when == null || task.ext.when task.ext.when == null || task.ext.when
@ -29,19 +33,24 @@ process MOSDEPTH {
script: script:
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}" def prefix = task.ext.prefix ?: "${meta.id}"
if (window_size) { def reference = fasta ? "--fasta ${fasta}" : ""
interval = "--by ${window_size}" def interval = bed ? "--by ${bed}" : ""
} else if ( bed ) { if (bed && args.contains("--by")) {
interval = "--by ${bed}" exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
} else {
interval = ""
} }
if (!bed && args.contains("--thresholds")) {
exit 1, "'--thresholds' can only be specified in conjunction with '--by'"
}
""" """
mosdepth \\ mosdepth \\
--threads $task.cpus \\
$interval \\ $interval \\
$reference \\
$args \\ $args \\
$prefix \\ $prefix \\
$bam $bam
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":
mosdepth: \$(mosdepth --version 2>&1 | sed 's/^.*mosdepth //; s/ .*\$//') mosdepth: \$(mosdepth --version 2>&1 | sed 's/^.*mosdepth //; s/ .*\$//')
@ -59,6 +68,10 @@ process MOSDEPTH {
touch ${prefix}.per-base.bed.gz.csi touch ${prefix}.per-base.bed.gz.csi
touch ${prefix}.regions.bed.gz touch ${prefix}.regions.bed.gz
touch ${prefix}.regions.bed.gz.csi touch ${prefix}.regions.bed.gz.csi
touch ${prefix}.quantized.bed.gz
touch ${prefix}.quantized.bed.gz.csi
touch ${prefix}.thresholds.bed.gz
touch ${prefix}.thresholds.bed.gz.csi
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":

View file

@ -30,10 +30,10 @@ input:
type: file type: file
description: BED file with intersected intervals description: BED file with intersected intervals
pattern: "*.{bed}" pattern: "*.{bed}"
- window_size: - fasta:
type: integer type: file
description: Window size description: Reference genome FASTA file
pattern: "[0-9]+" pattern: "*.{fa,fasta}"
output: output:
- meta: - meta:
type: map type: map
@ -60,6 +60,10 @@ output:
type: file type: file
description: Index file for BED file with per-base coverage description: Index file for BED file with per-base coverage
pattern: "*.{per-base.bed.gz.csi}" pattern: "*.{per-base.bed.gz.csi}"
- per_base_d4:
type: file
description: D4 file with per-base coverage
pattern: "*.{per-base.d4}"
- regions_bed: - regions_bed:
type: file type: file
description: BED file with per-region coverage description: BED file with per-region coverage
@ -68,6 +72,22 @@ output:
type: file type: file
description: Index file for BED file with per-region coverage description: Index file for BED file with per-region coverage
pattern: "*.{regions.bed.gz.csi}" pattern: "*.{regions.bed.gz.csi}"
- quantized_bed:
type: file
description: BED file with binned coverage
pattern: "*.{quantized.bed.gz}"
- quantized_csi:
type: file
description: Index file for BED file with binned coverage
pattern: "*.{quantized.bed.gz.csi}"
- thresholds_bed:
type: file
description: BED file with the number of bases in each region that are covered at or above each threshold
pattern: "*.{thresholds.bed.gz}"
- thresholds_csi:
type: file
description: Index file for BED file with threshold coverage
pattern: "*.{thresholds.bed.gz.csi}"
- versions: - versions:
type: file type: file
description: File containing software versions description: File containing software versions
@ -76,3 +96,4 @@ authors:
- "@joseespinosa" - "@joseespinosa"
- "@drpatelh" - "@drpatelh"
- "@ramprasadn" - "@ramprasadn"
- "@matthdsm"

View file

@ -2,16 +2,15 @@ process STAR_ALIGN {
tag "$meta.id" tag "$meta.id"
label 'process_high' label 'process_high'
// Note: 2.7X indices incompatible with AWS iGenomes. conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
conda (params.enable_conda ? 'bioconda::star=2.7.9a' : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/star:2.7.9a--h9ee0642_0' : 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
'quay.io/biocontainers/star:2.7.9a--h9ee0642_0' }" 'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
input: input:
tuple val(meta), path(reads) tuple val(meta), path(reads)
path index path index
path gtf path gtf
val star_ignore_sjdbgtf val star_ignore_sjdbgtf
val seq_platform val seq_platform
val seq_center val seq_center
@ -67,6 +66,8 @@ process STAR_ALIGN {
cat <<-END_VERSIONS > versions.yml cat <<-END_VERSIONS > versions.yml
"${task.process}": "${task.process}":
star: \$(STAR --version | sed -e "s/STAR_//g") star: \$(STAR --version | sed -e "s/STAR_//g")
samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
END_VERSIONS END_VERSIONS
""" """
} }

View file

@ -2,19 +2,18 @@ process STAR_GENOMEGENERATE {
tag "$fasta" tag "$fasta"
label 'process_high' label 'process_high'
// Note: 2.7X indices incompatible with AWS iGenomes. conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
conda (params.enable_conda ? "bioconda::star=2.7.9a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' : 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' }" 'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"
input: input:
path fasta path fasta
path gtf path gtf
output: output:
path "star" , emit: index path "star" , emit: index
path "versions.yml" , emit: versions path "versions.yml", emit: versions
when: when:
task.ext.when == null || task.ext.when task.ext.when == null || task.ext.when
@ -22,7 +21,7 @@ process STAR_GENOMEGENERATE {
script: script:
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def args_list = args.tokenize() def args_list = args.tokenize()
def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : '' def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
if (args_list.contains('--genomeSAindexNbases')) { if (args_list.contains('--genomeSAindexNbases')) {
""" """
mkdir star mkdir star

View file

@ -9,12 +9,13 @@ process UMITOOLS_DEDUP {
input: input:
tuple val(meta), path(bam), path(bai) tuple val(meta), path(bam), path(bai)
val get_output_stats
output: output:
tuple val(meta), path("*.bam") , emit: bam tuple val(meta), path("*.bam") , emit: bam
tuple val(meta), path("*edit_distance.tsv"), emit: tsv_edit_distance tuple val(meta), path("*edit_distance.tsv"), optional:true, emit: tsv_edit_distance
tuple val(meta), path("*per_umi.tsv") , emit: tsv_per_umi tuple val(meta), path("*per_umi.tsv") , optional:true, emit: tsv_per_umi
tuple val(meta), path("*per_position.tsv") , emit: tsv_umi_per_position tuple val(meta), path("*per_position.tsv") , optional:true, emit: tsv_umi_per_position
path "versions.yml" , emit: versions path "versions.yml" , emit: versions
when: when:
@ -24,12 +25,13 @@ process UMITOOLS_DEDUP {
def args = task.ext.args ?: '' def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}" def prefix = task.ext.prefix ?: "${meta.id}"
def paired = meta.single_end ? "" : "--paired" def paired = meta.single_end ? "" : "--paired"
def stats = get_output_stats ? "--output-stats $prefix" : ""
""" """
umi_tools \\ umi_tools \\
dedup \\ dedup \\
-I $bam \\ -I $bam \\
-S ${prefix}.bam \\ -S ${prefix}.bam \\
--output-stats $prefix \\ $stats \\
$paired \\ $paired \\
$args $args

View file

@ -26,6 +26,10 @@ input:
description: | description: |
BAM index files corresponding to the input BAM file. BAM index files corresponding to the input BAM file.
pattern: "*.{bai}" pattern: "*.{bai}"
- get_output_stats:
type: boolean
description: |
Whether or not to generate output stats.
output: output:
- meta: - meta:
type: map type: map

View file

@ -0,0 +1,67 @@
process VSEARCH_USEARCHGLOBAL {
tag "${meta.id}"
label 'process_low'
conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
input:
tuple val(meta), path(queryfasta)
path db
val idcutoff
val outoption
val user_columns
output:
tuple val(meta), path('*.aln') , optional: true, emit: aln
tuple val(meta), path('*.biom') , optional: true, emit: biom
tuple val(meta), path('*.lca') , optional: true, emit: lca
tuple val(meta), path('*.mothur') , optional: true, emit: mothur
tuple val(meta), path('*.otu') , optional: true, emit: otu
tuple val(meta), path('*.sam') , optional: true, emit: sam
tuple val(meta), path('*.tsv') , optional: true, emit: tsv
tuple val(meta), path('*.txt') , optional: true, emit: txt
tuple val(meta), path('*.uc') , optional: true, emit: uc
path "versions.yml" , emit: versions
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
def columns = user_columns ? "--userfields ${user_columns}" : ''
switch ( outoption ) {
case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
case "samout": outfmt = "--samout"; out_ext = 'sam'; break
case "uc": outfmt = "--uc"; out_ext = 'uc'; break
case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
default:
outfmt = "--alnout";
out_ext = 'aln';
log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
break
}
"""
vsearch \\
--usearch_global $queryfasta \\
--db $db \\
--id $idcutoff \\
--threads $task.cpus \\
$args \\
${columns} \\
${outfmt} ${prefix}.${out_ext}
cat <<-END_VERSIONS > versions.yml
"${task.process}":
vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
END_VERSIONS
"""
}

View file

@ -0,0 +1,83 @@
name: "vsearch_usearchglobal"
description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
keywords:
- vsearch
- usearch
- alignment
- fasta
tools:
- "vsearch":
description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
homepage: "https://github.com/torognes/vsearch"
documentation: "None"
tool_dev_url: "https://github.com/torognes/vsearch"
doi: "doi: 10.7717/peerj.2584"
licence: "['GPL v3-or-later OR BSD-2-clause']"
input:
- meta:
type: map
description: Groovy Map containing sample information e.g. [ id:'test' ]
- queryfasta:
type: file
description: Query sequences in FASTA format
pattern: "*.{fasta,fa,fna,faa}"
- db:
type: file
description: Reference database file in FASTA or UDB format
pattern: "*"
- idcutoff:
type: real
description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
- outoption:
type: string
description: Specify the type of output file to be generated by selecting one of the vsearch output file options
pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
- user_columns:
type: string
description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
output:
- aln:
type: file
description: Results in pairwise alignment format
pattern: "*.{aln}"
- biom:
type: file
description: Results in an OTU table in the biom version 1.0 file format
pattern: "*.{biom}"
- lca:
type: file
description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
pattern: "*.{lca}"
- mothur:
type: file
description: Results in an OTU table in the mothur shared tab-separated plain text file format
pattern: "*.{mothur}"
- otu:
type: file
description: Results in an OTU table in the classic tab-separated plain text format
pattern: "*.{otu}"
- sam:
type: file
description: Results written in sam format
pattern: "*.{sam}"
- tsv:
type: file
description: Results in tab-separated output, columns defined by user
pattern: "*.{tsv}"
- txt:
type: file
description: Tab delimited results in blast-like tabular format
pattern: "*.{txt}"
- uc:
type: file
description: Tab delimited results in a uclust-like format with 10 columns
pattern: "*.{uc}"
- versions:
type: file
description: File containing software versions
pattern: "versions.yml"
authors:
- "@jtangrot"

View file

@ -166,6 +166,10 @@ bcftools/reheader:
- modules/bcftools/reheader/** - modules/bcftools/reheader/**
- tests/modules/bcftools/reheader/** - tests/modules/bcftools/reheader/**
bcftools/roh:
- modules/bcftools/roh/**
- tests/modules/bcftools/roh/**
bcftools/sort: bcftools/sort:
- modules/bcftools/sort/** - modules/bcftools/sort/**
- tests/modules/bcftools/sort/** - tests/modules/bcftools/sort/**
@ -455,6 +459,10 @@ cnvkit/batch:
- modules/cnvkit/batch/** - modules/cnvkit/batch/**
- tests/modules/cnvkit/batch/** - tests/modules/cnvkit/batch/**
cnvkit/reference:
- modules/cnvkit/reference/**
- tests/modules/cnvkit/reference/**
controlfreec/assesssignificance: controlfreec/assesssignificance:
- modules/controlfreec/assesssignificance/** - modules/controlfreec/assesssignificance/**
- tests/modules/controlfreec/assesssignificance/** - tests/modules/controlfreec/assesssignificance/**
@ -703,9 +711,9 @@ freebayes:
- modules/freebayes/** - modules/freebayes/**
- tests/modules/freebayes/** - tests/modules/freebayes/**
gamma: gamma/gamma:
- modules/gamma/** - modules/gamma/gamma/**
- tests/modules/gamma/** - tests/modules/gamma/gamma/**
gatk4/applybqsr: gatk4/applybqsr:
- modules/gatk4/applybqsr/** - modules/gatk4/applybqsr/**
@ -743,6 +751,10 @@ gatk4/combinegvcfs:
- modules/gatk4/combinegvcfs/** - modules/gatk4/combinegvcfs/**
- tests/modules/gatk4/combinegvcfs/** - tests/modules/gatk4/combinegvcfs/**
gatk4/composestrtablefile:
- modules/gatk4/composestrtablefile/**
- tests/modules/gatk4/composestrtablefile/**
gatk4/createsequencedictionary: gatk4/createsequencedictionary:
- modules/gatk4/createsequencedictionary/** - modules/gatk4/createsequencedictionary/**
- tests/modules/gatk4/createsequencedictionary/** - tests/modules/gatk4/createsequencedictionary/**
@ -1085,6 +1097,10 @@ kallistobustools/ref:
- modules/kallistobustools/ref/** - modules/kallistobustools/ref/**
- tests/modules/kallistobustools/ref/** - tests/modules/kallistobustools/ref/**
kat/hist:
- modules/kat/hist/**
- tests/modules/kat/hist/**
khmer/normalizebymedian: khmer/normalizebymedian:
- modules/khmer/normalizebymedian/** - modules/khmer/normalizebymedian/**
- tests/modules/khmer/normalizebymedian/** - tests/modules/khmer/normalizebymedian/**
@ -2040,6 +2056,10 @@ vcftools:
- modules/vcftools/** - modules/vcftools/**
- tests/modules/vcftools/** - tests/modules/vcftools/**
vsearch/usearchglobal:
- modules/vsearch/usearchglobal/**
- tests/modules/vsearch/usearchglobal/**
yara/index: yara/index:
- modules/yara/index/** - modules/yara/index/**
- tests/modules/yara/index/** - tests/modules/yara/index/**

View file

@ -144,6 +144,7 @@ params {
genome_21_sizes = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/genome.sizes" genome_21_sizes = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/genome.sizes"
genome_21_interval_list = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list" genome_21_interval_list = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list"
genome_21_multi_interval_bed = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed" genome_21_multi_interval_bed = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed"
genome_21_multi_interval_antitarget_bed = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.antitarget.bed"
genome_21_multi_interval_bed_gz = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz" genome_21_multi_interval_bed_gz = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz"
genome_21_multi_interval_bed_gz_tbi = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi" genome_21_multi_interval_bed_gz_tbi = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi"
genome_21_chromosomes_dir = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz" genome_21_chromosomes_dir = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz"

View file

@ -4,13 +4,25 @@ nextflow.enable.dsl = 2
include { BCFTOOLS_CONCAT } from '../../../../modules/bcftools/concat/main.nf' include { BCFTOOLS_CONCAT } from '../../../../modules/bcftools/concat/main.nf'
workflow test_bcftools_concat { workflow test_bcftools_concat_tbi {
input = [ [ id:'test3' ], // meta map input = [ [ id:'test3' ], // meta map
[ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true), [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ] file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
[ file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test2_vcf_gz_tbi'], checkIfExists: true) ]
]
BCFTOOLS_CONCAT ( input )
}
workflow test_bcftools_concat_no_tbi {
input = [ [ id:'test3' ], // meta map
[ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
[]
] ]
BCFTOOLS_CONCAT ( input ) BCFTOOLS_CONCAT ( input )
} }

View file

@ -1,8 +1,17 @@
- name: bcftools concat test_bcftools_concat - name: bcftools concat test_bcftools_concat_tbi
command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_tbi -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config
tags: tags:
- bcftools/concat
- bcftools - bcftools
- bcftools/concat
files:
- path: output/bcftools/test3.vcf.gz
md5sum: 35c88bfaad20101062e98beb217d7137
- name: bcftools concat test_bcftools_concat_no_tbi
command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_no_tbi -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config
tags:
- bcftools
- bcftools/concat
files: files:
- path: output/bcftools/test3.vcf.gz - path: output/bcftools/test3.vcf.gz
md5sum: 35c88bfaad20101062e98beb217d7137 md5sum: 35c88bfaad20101062e98beb217d7137

View file

@ -0,0 +1,35 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { BCFTOOLS_ROH } from '../../../../modules/bcftools/roh/main.nf'
workflow test_bcftools_roh {
input = [ [ id:'test' ], // meta map
file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true)]
af_file = []
gen_map = []
regions = []
targets = []
samples = []
BCFTOOLS_ROH ( input, af_file, gen_map, regions, samples, targets )
}
workflow test_bcftools_roh_stub {
input = [ [ id:'test' ], // meta map
file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true)]
af_file = []
gen_map = []
regions = []
targets = []
samples = []
BCFTOOLS_ROH ( input, af_file, gen_map, regions, samples, targets )
}

View file

@ -0,0 +1,5 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
}

View file

@ -0,0 +1,17 @@
- name: "bcftools roh"
command: nextflow run ./tests/modules/bcftools/roh -entry test_bcftools_roh -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/roh/nextflow.config
tags:
- "bcftools"
- "bcftools/roh"
files:
- path: "output/bcftools/test.roh"
- path: "output/bcftools/versions.yml"
- name: "bcftools roh stub"
command: nextflow run ./tests/modules/bcftools/roh -entry test_bcftools_roh_stub -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/roh/nextflow.config
tags:
- "bcftools"
- "bcftools/roh"
files:
- path: "output/bcftools/test.roh"
- path: "output/bcftools/versions.yml"

View file

@ -0,0 +1,14 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { CNVKIT_REFERENCE } from '../../../../modules/cnvkit/reference/main.nf'
workflow test_cnvkit_reference {
fasta = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true)
targets = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_bed'], checkIfExists: true)
antitargets = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_antitarget_bed'], checkIfExists: true)
CNVKIT_REFERENCE ( fasta, targets, antitargets )
}

View file

@ -0,0 +1,5 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
}

View file

@ -0,0 +1,8 @@
- name: cnvkit reference test_cnvkit_reference
command: nextflow run ./tests/modules/cnvkit/reference -entry test_cnvkit_reference -c ./tests/config/nextflow.config -c ./tests/modules/cnvkit/reference/nextflow.config
tags:
- cnvkit/reference
- cnvkit
files:
- path: output/cnvkit/multi_intervals.reference.cnn
md5sum: 7c4a7902f5ab101b1f9d6038d331b3d9

View file

@ -2,4 +2,7 @@ process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
ext.args = "--min_length 10"
ext.prefix = "test_lr"
} }

View file

@ -1,23 +1,26 @@
- name: filtlong test_filtlong - name: filtlong test_filtlong
command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
tags: tags:
- filtlong - filtlong
files: files:
- path: output/filtlong/test_lr_filtlong.fastq.gz - path: output/filtlong/test_lr.fastq.gz
md5sum: 7029066c27ac6f5ef18d660d5741979a contains:
- "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
- name: filtlong test_filtlong_illumina_se - name: filtlong test_filtlong_illumina_se
command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
tags: tags:
- filtlong - filtlong
files: files:
- path: output/filtlong/test_lr_filtlong.fastq.gz - path: output/filtlong/test_lr.fastq.gz
md5sum: 7029066c27ac6f5ef18d660d5741979a contains:
- "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
- name: filtlong test_filtlong_illumina_pe - name: filtlong test_filtlong_illumina_pe
command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
tags: tags:
- filtlong - filtlong
files: files:
- path: output/filtlong/test_lr_filtlong.fastq.gz - path: output/filtlong/test_lr.fastq.gz
md5sum: 7029066c27ac6f5ef18d660d5741979a contains:
- "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"

View file

@ -0,0 +1,29 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { GAMMA_GAMMA } from '../../../../modules/gamma/gamma/main.nf'
workflow test_unzip {
input = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['bacteroides_fragilis']['illumina']['test1_contigs_fa_gz'], checkIfExists: true),
]
db = [ file("https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/delete_me/srst2/ResGANNCBI_20210507_srst2.fasta", checkIfExists: true), ]
GAMMA_GAMMA ( input, db )
}
workflow test_gamma {
input = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
]
db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
GAMMA_GAMMA ( input, db )
}

View file

@ -0,0 +1,29 @@
- name: gamma gamma test_unzip
command: nextflow run tests/modules/gamma/gamma -entry test_unzip -c tests/config/nextflow.config
tags:
- gamma/gamma
- gamma
files:
- path: output/gamma/test.fasta
md5sum: 5b3b831d863fffaa3410a9ee7bfa12ce
- path: output/gamma/test.gamma
md5sum: 46165a89e10b7315d3a9b0aa6c561626
- path: output/gamma/test.psl
md5sum: f489ce4602ddbcb692d5781ee3fbf449
- path: output/gamma/versions.yml
md5sum: 8baafec7b3b87f788f69e30d317c9722
- name: gamma gamma test_gamma
command: nextflow run tests/modules/gamma/gamma -entry test_gamma -c tests/config/nextflow.config
tags:
- gamma/gamma
- gamma
files:
- path: output/gamma/test.fasta
md5sum: df37b48466181311e0a679f3c5878484
- path: output/gamma/test.gamma
md5sum: 3256708fa517a65ed01d99e0e3c762ae
- path: output/gamma/test.psl
md5sum: 162a2757ed3b167ae1e0cdb24213f940
- path: output/gamma/versions.yml
md5sum: b75c2871d8cac2f8ac67c0fbd22babd6

View file

@ -1,17 +0,0 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { GAMMA } from '../../../modules/gamma/main.nf'
workflow test_gamma {
input = [
[ id:'test', single_end:false ], // meta map
file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
]
db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
GAMMA ( input, db )
}

View file

@ -1,13 +0,0 @@
- name: gamma test_gamma
command: nextflow run tests/modules/gamma -entry test_gamma -c tests/config/nextflow.config
tags:
- gamma
files:
- path: output/gamma/test.fasta
md5sum: df37b48466181311e0a679f3c5878484
- path: output/gamma/test.gamma
md5sum: 3256708fa517a65ed01d99e0e3c762ae
- path: output/gamma/test.psl
md5sum: 162a2757ed3b167ae1e0cdb24213f940
- path: output/gamma/versions.yml
md5sum: 3fefb5b46c94993362243c5f9a472057

View file

@ -0,0 +1,16 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { GATK4_COMPOSESTRTABLEFILE } from '../../../../modules/gatk4/composestrtablefile/main.nf'
workflow test_gatk4_composestrtablefile {
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
GATK4_COMPOSESTRTABLEFILE ( fasta, fasta_fai, dict )
}

View file

@ -0,0 +1,5 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
}

View file

@ -0,0 +1,7 @@
- name: gatk4 composestrtablefile test_gatk4_composestrtablefile
command: nextflow run ./tests/modules/gatk4/composestrtablefile -entry test_gatk4_composestrtablefile -c ./tests/config/nextflow.config -c ./tests/modules/gatk4/composestrtablefile/nextflow.config
tags:
- gatk4/composestrtablefile
- gatk4
files:
- path: output/gatk4/genome.zip

View file

@ -6,6 +6,8 @@
files: files:
- path: output/gatk4/test.vcf.gz - path: output/gatk4/test.vcf.gz
md5sum: 5b289bda88d3a3504f2e19ee8cff177c md5sum: 5b289bda88d3a3504f2e19ee8cff177c
- path: output/gatk4/test.vcf.gz.tbi
md5sum: a81673763b13086cfce9a23e72a35a16
- path: output/gatk4/versions.yml - path: output/gatk4/versions.yml
- name: gatk4 mergevcfs test_gatk4_mergevcfs_no_dict - name: gatk4 mergevcfs test_gatk4_mergevcfs_no_dict

View file

@ -0,0 +1,28 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { KAT_HIST } from '../../../../modules/kat/hist/main.nf'
workflow test_kat_hist_single_end {
input = [
[ id:'test', single_end:true ], // meta map
file(params.test_data['homo_sapiens']['illumina']['test2_1_fastq_gz'], checkIfExists: true)
]
KAT_HIST ( input )
}
workflow test_kat_hist_paired_end {
input = [
[ id:'test', single_end:false ], // meta map
[
file(params.test_data['homo_sapiens']['illumina']['test2_1_fastq_gz'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test2_2_fastq_gz'], checkIfExists: true),
]
]
KAT_HIST ( input )
}

View file

@ -0,0 +1,9 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
withName: 'test_kat_hist_single_end:KAT_HIST' {
ext.args = '-d'
}
}

View file

@ -0,0 +1,42 @@
- name: kat hist test_kat_hist_single_end
command: nextflow run tests/modules/kat/hist -entry test_kat_hist_single_end -c tests/config/nextflow.config
tags:
- kat/hist
- kat
files:
- path: output/kat/test.hist
md5sum: c6eba52b3a2653a684577a8ae20b74c1
- path: output/kat/test.hist-hash.jf27
- path: output/kat/test.hist.dist_analysis.json
# md5sum: 52a5a2d91c71b940f36f1f0a7fd5ef10 # This is variable for an unknown reason
contains:
- "nb_peaks"
- "global_minima"
- "global_maxima"
- "mean_freq"
- "est_genome_size"
- "est_het_rate"
- path: output/kat/test.hist.png
md5sum: 49861ef1a265e0edde3550b39c64a274
- path: output/kat/versions.yml
- name: kat hist test_kat_hist_paired_end
command: nextflow run tests/modules/kat/hist -entry test_kat_hist_paired_end -c tests/config/nextflow.config
tags:
- kat/hist
- kat
files:
- path: output/kat/test.hist
md5sum: 91429091e74b1718051591d83a1ccb5d
- path: output/kat/test.hist.dist_analysis.json
# md5sum: 8b0dabeaff4ba706b33aa8964d687e13 # This is variable for an unknown reason
contains:
- "nb_peaks"
- "global_minima"
- "global_maxima"
- "mean_freq"
- "est_genome_size"
- "est_het_rate"
- path: output/kat/test.hist.png
md5sum: e20774d0d2b979cb6ead7b7fb5ad36d9
- path: output/kat/versions.yml

View file

@ -14,8 +14,11 @@ workflow test_mash_screen {
file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
] ]
] ]
fastx_db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) sars_db = [
[ id: 'sars_db' ],
file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
]
MASH_SKETCH ( input ) MASH_SKETCH ( sars_db )
MASH_SCREEN ( MASH_SKETCH.out.mash, fastx_db ) MASH_SCREEN ( input, MASH_SKETCH.out.mash.map { meta, sketch -> sketch } )
} }

View file

@ -4,9 +4,9 @@
- mash - mash
- mash/screen - mash/screen
files: files:
- path: output/mash/test.mash_stats - path: output/mash/sars_db.mash_stats
md5sum: 2a6f297d8e69a5e4160243bc6c89129c md5sum: 1dafbd23e36e18bf4c87a007d0fc98f7
- path: output/mash/test.msh - path: output/mash/sars_db.msh
md5sum: d747145a43dad5f82342036f8f5d9133 md5sum: 24289e4a13526e88eeb2abfca4a0f0a8
- path: output/mash/test.screen - path: output/mash/test.screen
md5sum: d3c871dccd5cd57ab54781fa5c5d7278 md5sum: ac8701e1aab651b2f36c6380b1351b11

View file

@ -2,35 +2,95 @@
nextflow.enable.dsl = 2 nextflow.enable.dsl = 2
include { MOSDEPTH } from '../../../modules/mosdepth/main.nf' include { MOSDEPTH } from '../../../modules/mosdepth/main.nf'
include { MOSDEPTH as MOSDEPTH_FAIL } from '../../../modules/mosdepth/main.nf'
include { MOSDEPTH as MOSDEPTH_WINDOW } from '../../../modules/mosdepth/main.nf'
include { MOSDEPTH as MOSDEPTH_THRESHOLD } from '../../../modules/mosdepth/main.nf'
include { MOSDEPTH as MOSDEPTH_QUANTIZED } from '../../../modules/mosdepth/main.nf'
workflow test_mosdepth { workflow test_mosdepth {
input = [ [ id:'test', single_end:true ], input = [
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ], [ id:'test', single_end:true ],
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ] file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
] file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
]
MOSDEPTH ( input, [], [] ) MOSDEPTH ( input, [], [] )
} }
workflow test_mosdepth_window {
input = [ [ id:'test', single_end:true ],
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
]
window = 100
MOSDEPTH ( input, [], window )
}
workflow test_mosdepth_bed { workflow test_mosdepth_bed {
input = [ [ id:'test', single_end:true ], input = [
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ], [ id:'test', single_end:true ],
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ] file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
] file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
bed = [ file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) ] ]
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
MOSDEPTH ( input, bed, [] ) MOSDEPTH ( input, bed, [] )
} }
workflow test_mosdepth_cram {
input = [
[ id:'test', single_end:true ],
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
]
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
MOSDEPTH ( input, [], fasta )
}
workflow test_mosdepth_cram_bed {
input = [
[ id:'test', single_end:true ],
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
]
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
MOSDEPTH ( input, bed, fasta )
}
workflow test_mosdepth_window {
input = [
[ id:'test', single_end:true ],
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
]
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
MOSDEPTH_WINDOW ( input, [], [] )
}
workflow test_mosdepth_quantized {
input = [
[ id:'test', single_end:true ],
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
]
MOSDEPTH_QUANTIZED ( input, [], [] )
}
workflow test_mosdepth_thresholds {
input = [
[ id:'test', single_end:true ],
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
]
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
MOSDEPTH_THRESHOLD ( input, bed, [] )
}
workflow test_mosdepth_fail {
input = [
[ id:'test', single_end:true ],
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
]
bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
MOSDEPTH_FAIL ( input, bed, [] )
}

View file

@ -1,5 +1,16 @@
process { process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" } publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
withName: MOSDEPTH_FAIL {
ext.args = "--by 100"
}
withName: MOSDEPTH_WINDOW {
ext.args = "--by 100"
}
withName: MOSDEPTH_QUANTIZED {
ext.args = "--quantize 0:1:4:100:200"
}
withName: MOSDEPTH_THRESHOLD {
ext.args = "--thresholds 1,10,20,30"
}
} }

View file

@ -1,53 +1,135 @@
- name: mosdepth - name: mosdepth test_mosdepth
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
tags: tags:
- mosdepth - mosdepth
files: files:
- path: ./output/mosdepth/test.per-base.bed.gz.csi - path: output/mosdepth/test.mosdepth.global.dist.txt
md5sum: b2aad62c41a7146680d31df505fcc8c5 md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: ./output/mosdepth/test.per-base.bed.gz - path: output/mosdepth/test.mosdepth.summary.txt
md5sum: 11b3f649072c2c7453febb085b1a9c33 md5sum: 4f0d231060cbde4efdd673863bd2fb59
- path: ./output/mosdepth/test.mosdepth.global.dist.txt - path: output/mosdepth/test.per-base.bed.gz
md5sum: 2a1de1b0ecc361a21cd296ec4e1efd6a md5sum: bc1df47d46f818fee5275975925d769a
- path: ./output/mosdepth/test.mosdepth.summary.txt - path: output/mosdepth/test.per-base.bed.gz.csi
md5sum: 7b249dd3b3e58cc122fbd25ea84aa25d md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
- name: mosdepth window - name: mosdepth test_mosdepth_bed
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_window -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_bed -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
tags: tags:
- mosdepth - mosdepth
files: files:
- path: ./output/mosdepth/test.per-base.bed.gz.csi - path: output/mosdepth/test.mosdepth.global.dist.txt
md5sum: b2aad62c41a7146680d31df505fcc8c5 md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: ./output/mosdepth/test.per-base.bed.gz - path: output/mosdepth/test.mosdepth.region.dist.txt
md5sum: 11b3f649072c2c7453febb085b1a9c33 md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: ./output/mosdepth/test.mosdepth.global.dist.txt - path: output/mosdepth/test.mosdepth.summary.txt
md5sum: 2a1de1b0ecc361a21cd296ec4e1efd6a md5sum: 96c037f769974b904beb53edc4f56d82
- path: ./output/mosdepth/test.regions.bed.gz - path: output/mosdepth/test.per-base.bed.gz
md5sum: 64e1ced01c4443d7c1796ef553992f0c md5sum: bc1df47d46f818fee5275975925d769a
- path: ./output/mosdepth/test.regions.bed.gz.csi - path: output/mosdepth/test.per-base.bed.gz.csi
md5sum: 9e312b4b0784bd46dfbd23b3a8afed6a md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
- path: ./output/mosdepth/test.mosdepth.region.dist.txt - path: output/mosdepth/test.regions.bed.gz
md5sum: 65fbc824c4212c6884354d8ac72ad37e md5sum: 5d398caf7171ec4406278e2add3009ae
- path: ./output/mosdepth/test.mosdepth.summary.txt - path: output/mosdepth/test.regions.bed.gz.csi
md5sum: 11804907dab069ddb99ca97bf2698572 md5sum: 47669cfe41f3e222e74d81e1b1be191f
- name: mosdepth bed - name: mosdepth test_mosdepth_cram
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_bed -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_cram -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
tags: tags:
- mosdepth - mosdepth
files: files:
- path: ./output/mosdepth/test.per-base.bed.gz.csi - path: output/mosdepth/test.mosdepth.global.dist.txt
md5sum: b2aad62c41a7146680d31df505fcc8c5 md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: ./output/mosdepth/test.per-base.bed.gz - path: output/mosdepth/test.mosdepth.summary.txt
md5sum: 11b3f649072c2c7453febb085b1a9c33 md5sum: 4f0d231060cbde4efdd673863bd2fb59
- path: ./output/mosdepth/test.mosdepth.global.dist.txt - path: output/mosdepth/test.per-base.bed.gz
md5sum: 2a1de1b0ecc361a21cd296ec4e1efd6a md5sum: bc1df47d46f818fee5275975925d769a
- path: ./output/mosdepth/test.regions.bed.gz - path: output/mosdepth/test.per-base.bed.gz.csi
md5sum: 347f877700d1dc42c95157199eff25d5 md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
- path: ./output/mosdepth/test.regions.bed.gz.csi
md5sum: ed5fbf46e3bdcbf60094df295bc40356 - name: mosdepth test_mosdepth_cram_bed
- path: ./output/mosdepth/test.mosdepth.region.dist.txt command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_cram_bed -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
md5sum: 295564628113d2ec0ca34d7f661cfea8 tags:
- path: ./output/mosdepth/test.mosdepth.summary.txt - mosdepth
md5sum: b07817412fd17819c14541e63bc4926c files:
- path: output/mosdepth/test.mosdepth.global.dist.txt
md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: output/mosdepth/test.mosdepth.region.dist.txt
md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: output/mosdepth/test.mosdepth.summary.txt
md5sum: 96c037f769974b904beb53edc4f56d82
- path: output/mosdepth/test.per-base.bed.gz
md5sum: bc1df47d46f818fee5275975925d769a
- path: output/mosdepth/test.per-base.bed.gz.csi
md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
- path: output/mosdepth/test.regions.bed.gz
md5sum: 5d398caf7171ec4406278e2add3009ae
- path: output/mosdepth/test.regions.bed.gz.csi
md5sum: 47669cfe41f3e222e74d81e1b1be191f
- name: mosdepth test_mosdepth_window
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_window -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
tags:
- mosdepth
files:
- path: output/mosdepth/test.mosdepth.global.dist.txt
md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: output/mosdepth/test.mosdepth.region.dist.txt
md5sum: 39e0e707ec32feb5176fd20a95f1f468
- path: output/mosdepth/test.mosdepth.summary.txt
md5sum: 96c037f769974b904beb53edc4f56d82
- path: output/mosdepth/test.per-base.bed.gz
md5sum: bc1df47d46f818fee5275975925d769a
- path: output/mosdepth/test.per-base.bed.gz.csi
md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
- path: output/mosdepth/test.regions.bed.gz
md5sum: f02e2cb49cc050e13d76942d6960827a
- path: output/mosdepth/test.regions.bed.gz.csi
md5sum: 257d67678136963d9dd904330079609d
- name: mosdepth test_mosdepth_quantized
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_quantized -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
tags:
- mosdepth
files:
- path: output/mosdepth/test.mosdepth.global.dist.txt
md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: output/mosdepth/test.mosdepth.summary.txt
md5sum: 4f0d231060cbde4efdd673863bd2fb59
- path: output/mosdepth/test.per-base.bed.gz
md5sum: bc1df47d46f818fee5275975925d769a
- path: output/mosdepth/test.per-base.bed.gz.csi
md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
- path: output/mosdepth/test.quantized.bed.gz
md5sum: 3e434a8bafcf59a67841ae3d4d752838
- path: output/mosdepth/test.quantized.bed.gz.csi
md5sum: be9617f551f19a33923f1e886eaefb93
- name: mosdepth test_mosdepth_thresholds
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_thresholds -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
tags:
- mosdepth
files:
- path: output/mosdepth/test.mosdepth.global.dist.txt
md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: output/mosdepth/test.mosdepth.region.dist.txt
md5sum: e82e90c7d508a135b5a8a7cd6933452e
- path: output/mosdepth/test.mosdepth.summary.txt
md5sum: 96c037f769974b904beb53edc4f56d82
- path: output/mosdepth/test.per-base.bed.gz
md5sum: bc1df47d46f818fee5275975925d769a
- path: output/mosdepth/test.per-base.bed.gz.csi
md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
- path: output/mosdepth/test.regions.bed.gz
md5sum: 5d398caf7171ec4406278e2add3009ae
- path: output/mosdepth/test.regions.bed.gz.csi
md5sum: 47669cfe41f3e222e74d81e1b1be191f
- path: output/mosdepth/test.thresholds.bed.gz
md5sum: 13101e326eea3cbfa1d569b69f494f4c
- path: output/mosdepth/test.thresholds.bed.gz.csi
md5sum: 912055ee9452229439df6fae95644196
- name: mosdepth test_mosdepth_fail
command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_fail -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
tags:
- mosdepth
exit_code: 1

View file

@ -36,7 +36,7 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: b9f5e2f6a624b64c300fe25dc3ac801f md5sum: 63de6af2210e138b49d7b4d570c6e67f
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out
@ -80,7 +80,7 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: 38d08f0b944a2a1b981a250d675aa0d9 md5sum: 7cdef439bc8092bfefb4d091bf8ee6ab
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out
@ -124,7 +124,7 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: c740d5177067c1fcc48ab7a16cd639d7 md5sum: 5dbc36fce7b72628c809bbc7d3d67973
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out
@ -168,9 +168,9 @@
- path: output/star/star/transcriptInfo.tab - path: output/star/star/transcriptInfo.tab
md5sum: 0c3a5adb49d15e5feff81db8e29f2e36 md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
- path: output/star/test.Aligned.out.bam - path: output/star/test.Aligned.out.bam
md5sum: a1bd1b40950a58ea2776908076160052 md5sum: d85858bf55a523121dde762046a34c5c
- path: output/star/test.Chimeric.out.junction - path: output/star/test.Chimeric.out.junction
md5sum: 327629eb54032212f29e1c32cbac6975 md5sum: ae87d1a24180f5a35cf6b47fdfdd0539
- path: output/star/test.Log.final.out - path: output/star/test.Log.final.out
- path: output/star/test.Log.out - path: output/star/test.Log.out
- path: output/star/test.Log.progress.out - path: output/star/test.Log.progress.out

View file

@ -3,54 +3,81 @@
nextflow.enable.dsl = 2 nextflow.enable.dsl = 2
include { UMITOOLS_EXTRACT } from '../../../../modules/umitools/extract/main.nf' include { UMITOOLS_EXTRACT } from '../../../../modules/umitools/extract/main.nf'
include { BWA_INDEX } from '../../../../modules/bwa/index/main.nf' include { BWA_INDEX } from '../../../../modules/bwa/index/main.nf'
include { BWA_MEM } from '../../../../modules/bwa/mem/main.nf' include { BWA_MEM } from '../../../../modules/bwa/mem/main.nf'
include { SAMTOOLS_INDEX } from '../../../../modules/samtools/index/main.nf' include { SAMTOOLS_INDEX } from '../../../../modules/samtools/index/main.nf'
include { UMITOOLS_DEDUP } from '../../../../modules/umitools/dedup/main.nf' include { UMITOOLS_DEDUP } from '../../../../modules/umitools/dedup/main.nf'
// //
// Test with no UMI // Test with no UMI
// //
workflow test_umitools_dedup_no_umi { workflow test_umitools_dedup_no_umi {
input = [ [ id:'test'], // meta map input = [
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ], [ id:'test'], // meta map
[ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ] file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
] file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
]
get_output_stats = false
UMITOOLS_DEDUP ( input ) UMITOOLS_DEDUP ( input, get_output_stats )
} }
// //
// Test with single-end data // Test with single-end data without --output-stats
// //
workflow test_umitools_dedup_single_end { workflow test_umitools_dedup_single_end_no_stats {
input = [ [ id:'test', single_end:true ], // meta map input = [
[ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] [ id:'test', single_end:true ], // meta map
] file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
]
fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
get_output_stats = false
UMITOOLS_EXTRACT ( input ) UMITOOLS_EXTRACT ( input )
BWA_INDEX ( fasta ) BWA_INDEX ( fasta )
BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true ) BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true )
SAMTOOLS_INDEX (BWA_MEM.out.bam) SAMTOOLS_INDEX ( BWA_MEM.out.bam )
UMITOOLS_DEDUP(BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0])) UMITOOLS_DEDUP ( BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]), get_output_stats )
} }
// //
// Test with paired-end data // Test with paired-end data without --output-stats
// //
workflow test_umitools_dedup_paired_end { workflow test_umitools_dedup_paired_end_no_stats {
input = [ [ id:'test', single_end:false ], // meta map input = [
[ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), [ id:'test', single_end:false ], // meta map
file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] [
] file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
]
]
fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
get_output_stats = false
UMITOOLS_EXTRACT ( input ) UMITOOLS_EXTRACT ( input )
BWA_INDEX ( fasta ) BWA_INDEX ( fasta )
BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true ) BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true )
SAMTOOLS_INDEX (BWA_MEM.out.bam) SAMTOOLS_INDEX ( BWA_MEM.out.bam )
UMITOOLS_DEDUP(BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0])) UMITOOLS_DEDUP ( BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]), get_output_stats )
}
//
// Test with paired-end data with --output-stats
//
workflow test_umitools_dedup_paired_end_stats {
input = [
[ id:'test', single_end:false ], // meta map
[
file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
]
]
fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
get_output_stats = true
UMITOOLS_EXTRACT ( input )
BWA_INDEX ( fasta )
BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true )
SAMTOOLS_INDEX ( BWA_MEM.out.bam )
UMITOOLS_DEDUP ( BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]), get_output_stats )
} }

View file

@ -7,11 +7,7 @@ process {
} }
withName: UMITOOLS_DEDUP { withName: UMITOOLS_DEDUP {
ext.args = '' ext.prefix = { "${meta.id}.dedup" }
ext.prefix = 'dedup'
} }
withName: BWA_MEM {
ext.args2 = ''
}
} }

View file

@ -1,54 +1,87 @@
- name: umitools dedup test_umitools_dedup_no_umi - name: umitools dedup test_umitools_dedup_no_umi
command: nextflow run tests/modules/umitools/dedup -entry test_umitools_dedup_no_umi -c tests/config/nextflow.config command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_no_umi -c ./tests/config/nextflow.config -c ./tests/modules/umitools/dedup/nextflow.config
tags: tags:
- umitools/dedup - umitools/dedup
- umitools - umitools
files: files:
- path: output/umitools/dedup.bam - path: output/umitools/test.dedup.bam
md5sum: 53b4edc399db81b87d2343e78af73cf0
- path: output/umitools/dedup_edit_distance.tsv
md5sum: 65186b0964e2f8d970cc04d736d8b119
- path: output/umitools/dedup_per_umi.tsv
md5sum: 8e6783a4a79437b095f095f2aefe7c01
- path: output/umitools/dedup_per_umi_per_position.tsv
md5sum: 9386db4a104b8e4e32f3ca4a84efa4ac
- path: output/umitools/versions.yml
md5sum: 4aaaa33565bcd9a984255139933d6446
- name: umitools dedup test_umitools_dedup_single_end - name: umitools dedup test_umitools_dedup_single_end_no_stats
command: nextflow run tests/modules/umitools/dedup -entry test_umitools_dedup_single_end -c tests/config/nextflow.config command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_single_end_no_stats -c ./tests/config/nextflow.config -c ./tests/modules/umitools/dedup/nextflow.config
tags: tags:
- umitools
- umitools/dedup - umitools/dedup
- umitools
files: files:
- path: output/bwa/bwa/genome.amb
md5sum: 3a68b8b2287e07dd3f5f95f4344ba76e
- path: output/bwa/bwa/genome.ann
md5sum: c32e11f6c859f166c7525a9c1d583567
- path: output/bwa/bwa/genome.bwt
md5sum: 0469c30a1e239dd08f68afe66fde99da
- path: output/bwa/bwa/genome.pac
md5sum: 983e3d2cd6f36e2546e6d25a0da78d66
- path: output/bwa/bwa/genome.sa
md5sum: ab3952cabf026b48cd3eb5bccbb636d1
- path: output/bwa/test.bam - path: output/bwa/test.bam
md5sum: ea41a3cdca1856b22845e1067fd31f37 md5sum: 3ecbe569cadb9b6c881917ce60779f75
- path: output/bwa/versions.yml
md5sum: ce4d987f2c53f4c01b31d210c357b24a
- path: output/samtools/test.bam.bai - path: output/samtools/test.bam.bai
md5sum: 095af0ad3921212597ffd7c342ecd5a0 md5sum: 095af0ad3921212597ffd7c342ecd5a0
- path: output/samtools/versions.yml - path: output/umitools/test.dedup.bam
md5sum: 69b7cde627c9b4e8403dfc125db71cc7 - path: output/umitools/test.umi_extract.fastq.gz
- path: output/umitools/dedup.bam - path: output/umitools/test.umi_extract.log
md5sum: d95df177063432748ff33f473910cb1e
- path: output/umitools/versions.yml
md5sum: 730e768dd199d2f5bfb6fd0850446344
- name: umitools dedup test_umitools_dedup_paired_end - name: umitools dedup test_umitools_dedup_paired_end_no_stats
command: nextflow run tests/modules/umitools/dedup -entry test_umitools_dedup_paired_end -c tests/config/nextflow.config command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_paired_end_no_stats -c ./tests/config/nextflow.config -c ./tests/modules/umitools/dedup/nextflow.config
tags: tags:
- umitools
- umitools/dedup - umitools/dedup
- umitools
files: files:
- path: output/bwa/bwa/genome.amb
md5sum: 3a68b8b2287e07dd3f5f95f4344ba76e
- path: output/bwa/bwa/genome.ann
md5sum: c32e11f6c859f166c7525a9c1d583567
- path: output/bwa/bwa/genome.bwt
md5sum: 0469c30a1e239dd08f68afe66fde99da
- path: output/bwa/bwa/genome.pac
md5sum: 983e3d2cd6f36e2546e6d25a0da78d66
- path: output/bwa/bwa/genome.sa
md5sum: ab3952cabf026b48cd3eb5bccbb636d1
- path: output/bwa/test.bam - path: output/bwa/test.bam
md5sum: 1ad786cae0ff2254c655e3a206929617 md5sum: e7dcbac1825bf210409b762dbb4fec8f
- path: output/bwa/versions.yml
md5sum: b524c5ddf61c20f4a0a93ae8fc78b851
- path: output/samtools/test.bam.bai - path: output/samtools/test.bam.bai
md5sum: 7496f4056a8e86327ca93e350f282fc2 md5sum: f75780d1de7860329b7fb4afeadc4bed
- path: output/samtools/versions.yml - path: output/umitools/test.dedup.bam
md5sum: 72fc2ab934fd4bca0f7f14a705530d34 - path: output/umitools/test.umi_extract.log
- path: output/umitools/dedup.bam - path: output/umitools/test.umi_extract_1.fastq.gz
md5sum: e8d1eae2aacef76254948c5568e94555 - path: output/umitools/test.umi_extract_2.fastq.gz
- path: output/umitools/versions.yml
md5sum: fd39e05042d354b3d8de49b617d3183d - name: umitools dedup test_umitools_dedup_paired_end_stats
command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_paired_end_stats -c ./tests/config/nextflow.config -c ./tests/modules/umitools/dedup/nextflow.config
tags:
- umitools/dedup
- umitools
files:
- path: output/bwa/bwa/genome.amb
md5sum: 3a68b8b2287e07dd3f5f95f4344ba76e
- path: output/bwa/bwa/genome.ann
md5sum: c32e11f6c859f166c7525a9c1d583567
- path: output/bwa/bwa/genome.bwt
md5sum: 0469c30a1e239dd08f68afe66fde99da
- path: output/bwa/bwa/genome.pac
md5sum: 983e3d2cd6f36e2546e6d25a0da78d66
- path: output/bwa/bwa/genome.sa
md5sum: ab3952cabf026b48cd3eb5bccbb636d1
- path: output/bwa/test.bam
md5sum: e7dcbac1825bf210409b762dbb4fec8f
- path: output/samtools/test.bam.bai
md5sum: f75780d1de7860329b7fb4afeadc4bed
- path: output/umitools/test.dedup.bam
- path: output/umitools/test.dedup_edit_distance.tsv
md5sum: c247a49b58768e6e2e86a6c08483e612
- path: output/umitools/test.dedup_per_umi.tsv
md5sum: 10e35ca37f2bfb521ac6dd7314951a68
- path: output/umitools/test.dedup_per_umi_per_position.tsv
md5sum: 2e1a12e6f720510880068deddeefe063
- path: output/umitools/test.umi_extract.log
- path: output/umitools/test.umi_extract_1.fastq.gz
- path: output/umitools/test.umi_extract_2.fastq.gz

View file

@ -0,0 +1,25 @@
#!/usr/bin/env nextflow
nextflow.enable.dsl = 2
include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
workflow test_vsearch_usearchglobal {
query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
idcutoff = 0.985
outoption = "xcfert" // Nonsense text to check default case.
columns = ""
VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
}
workflow test_vsearch_usearchglobal_userout {
query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
idcutoff = 0.985
outoption = "userout"
columns = "query+target+id"
VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
}

View file

@ -0,0 +1,4 @@
process {
publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
}

View file

@ -0,0 +1,26 @@
- name: vsearch usearchglobal test_vsearch_usearchglobal
command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
tags:
- vsearch/usearchglobal
- vsearch
files:
- path: output/vsearch/test.aln
contains:
- "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
- "Query >lcl|MT192765.1_cds_QIK50427.1_2"
- "%Id TLen Target"
- "100% 29829 MT192765.1"
- "Query 3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
- "Target 29829nt >MT192765.1"
- "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
- "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
- "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config -c ./tests/modules/vsearch/usearchglobal/nextflow.config
tags:
- vsearch/usearchglobal
- vsearch
files:
- path: output/vsearch/test.tsv
md5sum: b6cc50f7c8d18cb82e74dab70ed4baab