Merge remote-tracking branch 'origin/master' into cnvkit_bam

2024-12-22 11:08:17 +00:00 · 2022-06-01 17:35:47 +02:00 · 2022-06-01 17:35:47 +02:00 · 9fc9be3e7b
commit 9fc9be3e7b
parent f6953b5147 95e8afe627
62 changed files with 1401 additions and 246 deletions
--- a/modules/bamtools/convert/meta.yml
+++ b/modules/bamtools/convert/meta.yml
@ -42,7 +42,6 @@ output:
      type: file
      description: File containing software versions
      pattern: "versions.yml"
-  ## TODO nf-core: Delete / customise this example output
  - out:
      type: file
      description: The data in the asked format (bed, fasta, fastq, json, pileup, sam, yaml)
--- a/modules/bcftools/concat/main.nf
+++ b/modules/bcftools/concat/main.nf
@ -8,7 +8,7 @@ process BCFTOOLS_CONCAT {
        'quay.io/biocontainers/bcftools:1.14--h88f3f91_0' }"

    input:
-    tuple val(meta), path(vcfs)
+    tuple val(meta), path(vcfs), path(tbi)

    output:
    tuple val(meta), path("*.gz"), emit: vcf
--- a/modules/bcftools/concat/meta.yml
+++ b/modules/bcftools/concat/meta.yml
@ -25,6 +25,11 @@ input:
      description: |
        List containing 2 or more vcf files
        e.g. [ 'file1.vcf', 'file2.vcf' ]
+  - tbi:
+      type: files
+      description: |
+        List containing 2 or more index files (optional)
+        e.g. [ 'file1.tbi', 'file2.tbi' ]
 output:
  - meta:
      type: map
--- a/modules/bcftools/roh/main.nf
+++ b/modules/bcftools/roh/main.nf
@ -0,0 +1,61 @@
+process BCFTOOLS_ROH {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda (params.enable_conda ? "bioconda::bcftools=1.15.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/bcftools:1.15.1--h0ea216a_0':
+        'quay.io/biocontainers/bcftools:1.15.1--h0ea216a_0' }"
+
+    input:
+    tuple val(meta), path(vcf), path(tbi)
+    path af_file
+    path genetic_map
+    path regions_file
+    path samples_file
+    path targets_file
+
+    output:
+    tuple val(meta), path("*.roh"), emit: roh
+    path "versions.yml"           , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args      = task.ext.args   ?: ''
+    def prefix    = task.ext.prefix ?: "${meta.id}"
+    def af_read   = af_file         ? "--AF-file ${af_file}"           : ''
+    def gen_map   = genetic_map     ? "--genetic-map ${genetic_map}"   : ''
+    def reg_file  = regions_file    ? "--regions-file ${regions_file}" : ''
+    def samp_file = samples_file    ? "--samples-file ${samples_file}" : ''
+    def targ_file = targets_file    ? "--targets-file ${targets_file}" : ''
+    """
+    bcftools \\
+        roh \\
+        $args \\
+        $af_read \\
+        $gen_map \\
+        $reg_file \\
+        $samp_file \\
+        $targ_file \\
+        -o ${prefix}.roh \\
+        $vcf
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        bcftools: \$(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*\$//')
+    END_VERSIONS
+    """
+
+    stub:
+    def prefix    = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.roh
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        bcftools: \$(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*\$//')
+    END_VERSIONS
+    """
+}
--- a/modules/bcftools/roh/meta.yml
+++ b/modules/bcftools/roh/meta.yml
@ -0,0 +1,55 @@
+name: "bcftools_roh"
+description: A program for detecting runs of homo/autozygosity. Only bi-allelic sites are considered.
+keywords:
+  - roh
+tools:
+  - "roh":
+      description: "A program for detecting runs of homo/autozygosity. Only bi-allelic sites are considered."
+      homepage: https://www.htslib.org/
+      documentation: http://www.htslib.org/doc/bcftools.html
+      doi: 10.1093/bioinformatics/btp352
+      licence: ["MIT"]
+
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - vcf:
+      type: file
+      description: VCF file
+      pattern: "*.{vcf,.vcf.gz}"
+  - af_file:
+      type: file
+      description: "Read allele frequencies from a tab-delimited file containing the columns: CHROM\tPOS\tREF,ALT\tAF."
+  - genetic_map:
+      type: file
+      description: "Genetic map in the format required also by IMPUTE2."
+  - regions_file:
+      type: file
+      description: "Regions can be specified either on command line or in a VCF, BED, or tab-delimited file (the default)."
+  - samples_file:
+      type: file
+      description: "File of sample names to include or exclude if prefixed with '^'."
+  - targets_file:
+      type: file
+      description: "Targets can be specified either on command line or in a VCF, BED, or tab-delimited file (the default)."
+
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - roh:
+      type: file
+      description: Contains site-specific and/or per-region runs of homo/autozygosity calls.
+      pattern: "*.{roh}"
+
+authors:
+  - "@ramprasadn"
--- a/modules/cnvkit/reference/main.nf
+++ b/modules/cnvkit/reference/main.nf
@ -0,0 +1,40 @@
+process CNVKIT_REFERENCE {
+    tag "$fasta"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::cnvkit=0.9.9" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/cnvkit:0.9.9--pyhdfd78af_0':
+        'quay.io/biocontainers/cnvkit:0.9.9--pyhdfd78af_0' }"
+
+    input:
+    path fasta
+    path targets
+    path antitargets
+
+    output:
+    path "*.cnn"       , emit: cnn
+    path "versions.yml", emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: targets.BaseName
+
+    """
+    cnvkit.py \\
+        reference \\
+        --fasta $fasta \\
+        --targets $targets \\
+        --antitargets $antitargets \\
+        --output ${prefix}.reference.cnn \\
+        $args
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        cnvkit: \$(cnvkit.py version | sed -e "s/cnvkit v//g")
+    END_VERSIONS
+    """
+}
--- a/modules/cnvkit/reference/meta.yml
+++ b/modules/cnvkit/reference/meta.yml
@ -0,0 +1,47 @@
+name: cnvkit_reference
+description:
+keywords:
+  - cnvkit
+  - reference
+tools:
+  - cnvkit:
+      description: |
+        CNVkit is a Python library and command-line software toolkit to infer and visualize copy number from high-throughput DNA sequencing data.
+        It is designed for use with hybrid capture, including both whole-exome and custom target panels, and short-read sequencing platforms such as Illumina and Ion Torrent.
+      homepage: https://cnvkit.readthedocs.io/en/stable/index.html
+      documentation: https://cnvkit.readthedocs.io/en/stable/index.html
+      tool_dev_url: https://github.com/etal/cnvkit
+      doi: 10.1371/journal.pcbi.1004873
+      licence: ["Apache-2.0"]
+
+input:
+  - fasta:
+      type: file
+      description: File containing reference genome
+      pattern: "*.{fasta}"
+  - targets:
+      type: file
+      description: File containing genomic regions
+      pattern: "*.{bed}"
+  - antitargets:
+      type: file
+      description: File containing off-target genomic regions
+      pattern: "*.{bed}"
+
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reference:
+      type: file
+      description: File containing a copy-number reference (required for CNV calling in tumor_only mode)
+      pattern: "*.{cnn}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+
+authors:
+  - "@SusiJo"
--- a/modules/filtlong/main.nf
+++ b/modules/filtlong/main.nf
@ -11,7 +11,7 @@ process FILTLONG {
    tuple val(meta), path(shortreads), path(longreads)

    output:
-    tuple val(meta), path("${meta.id}_lr_filtlong.fastq.gz"), emit: reads
+    tuple val(meta), path("*.fastq.gz"), emit: reads
    path "versions.yml"                                     , emit: versions

    when:
@ -20,13 +20,14 @@ process FILTLONG {
    script:
    def args = task.ext.args ?: ''
    def prefix = task.ext.prefix ?: "${meta.id}"
-    def short_reads = meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
+    def short_reads = !shortreads ? "" : meta.single_end ? "-1 $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}"
+    if ("$longreads" == "${prefix}.fastq.gz") error "Longread FASTQ input and output names are the same, set prefix in module configuration to disambiguate!"
    """
    filtlong \\
        $short_reads \\
        $args \\
        $longreads \\
-        | gzip -n > ${prefix}_lr_filtlong.fastq.gz
+        | gzip -n > ${prefix}.fastq.gz

    cat <<-END_VERSIONS > versions.yml
    "${task.process}":
--- a/modules/gamma/gamma/main.nf
+++ b/modules/gamma/gamma/main.nf
@ -1,6 +1,6 @@
 def VERSION = '2.1' // Version information not provided by tool on CLI

-process GAMMA {
+process GAMMA_GAMMA {
    tag "$meta.id"
    label 'process_low'

@ -26,13 +26,24 @@ process GAMMA {
    script:
    def args = task.ext.args ?: ''
    def prefix = task.ext.prefix ?: "${meta.id}"
+
    """
-    GAMMA.py \\
+    if [[ ${fasta} == *.gz ]]
+    then
+        FNAME=\$(basename ${fasta} .gz)
+        gunzip -f ${fasta}
+        GAMMA.py \\
+        $args \\
+        "\${FNAME}" \\
+        $db \\
+        $prefix
+    else
+        GAMMA.py \\
        $args \\
        $fasta \\
        $db \\
        $prefix
-
+    fi
    cat <<-END_VERSIONS > versions.yml
    "${task.process}":
        gamma: $VERSION
--- a/modules/gamma/gamma/meta.yml
+++ b/modules/gamma/gamma/meta.yml
@ -1,4 +1,4 @@
-name: "gamma"
+name: "gamma_gamma"
 description: Gene Allele Mutation Microbial Assessment
 keywords:
  - gamma
@ -61,3 +61,4 @@ output:
 authors:
  - "@sateeshperi"
  - "@rastanton"
+  - "@jvhagey"
--- a/modules/gatk4/composestrtablefile/main.nf
+++ b/modules/gatk4/composestrtablefile/main.nf
@ -0,0 +1,53 @@
+process GATK4_COMPOSESTRTABLEFILE {
+    tag "$fasta"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::gatk4=4.2.6.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/gatk4:4.2.6.1--hdfd78af_0':
+        'quay.io/biocontainers/gatk4:4.2.6.1--hdfd78af_0' }"
+
+    input:
+    path(fasta)
+    path(fasta_fai)
+    path(dict)
+
+    output:
+    path "*.zip"            , emit: str_table
+    path "versions.yml"     , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+
+    def avail_mem = 6
+    if (!task.memory) {
+        log.info '[GATK ComposeSTRTableFile] Available memory not known - defaulting to 6GB. Specify process memory requirements to change this.'
+    } else {
+        avail_mem = task.memory.giga
+    }
+    """
+    gatk --java-options "-Xmx${avail_mem}g" ComposeSTRTableFile \\
+        --reference $fasta \\
+        --output ${fasta.baseName}.zip \\
+        --tmp-dir . \\
+        $args
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
+    END_VERSIONS
+    """
+
+    stub:
+    """
+    touch test.zip
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//')
+    END_VERSIONS
+    """
+}
--- a/modules/gatk4/composestrtablefile/meta.yml
+++ b/modules/gatk4/composestrtablefile/meta.yml
@ -0,0 +1,43 @@
+name: "gatk4_composestrtablefile"
+description: This tool looks for low-complexity STR sequences along the reference that are later used to estimate the Dragstr model during single sample auto calibration CalibrateDragstrModel.
+keywords:
+  - gatk4
+  - composestrtablefile
+tools:
+  - gatk4:
+      description:
+        Genome Analysis Toolkit (GATK4). Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools
+        with a primary focus on variant discovery and genotyping. Its powerful processing engine
+        and high-performance computing features make it capable of taking on projects of any size.
+      homepage: https://gatk.broadinstitute.org/hc/en-us
+      documentation: https://gatk.broadinstitute.org/hc/en-us/articles/4405451249819-ComposeSTRTableFile
+      tool_dev_url: https://github.com/broadinstitute/gatk
+      doi: 10.1158/1538-7445.AM2017-3590
+      licence: ["Apache-2.0"]
+
+input:
+  - fasta:
+      type: file
+      description: FASTA reference file
+      pattern: "*.{fasta,fa}"
+  - fasta_fai:
+      type: file
+      description: index of the FASTA reference file
+      pattern: "*.fai"
+  - dict:
+      type: file
+      description: Sequence dictionary of the FASTA reference file
+      pattern: "*.dict"
+
+output:
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - str_table:
+      type: file
+      description: A zipped folder containing the STR table files
+      pattern: "*.zip"
+
+authors:
+  - "@nvnieuwk"
--- a/modules/gatk4/mergevcfs/main.nf
+++ b/modules/gatk4/mergevcfs/main.nf
@ -13,6 +13,7 @@ process GATK4_MERGEVCFS {

    output:
    tuple val(meta), path('*.vcf.gz'), emit: vcf
+    tuple val(meta), path("*.tbi")   , emit: tbi
    path  "versions.yml"             , emit: versions

    when:
--- a/modules/gatk4/mergevcfs/meta.yml
+++ b/modules/gatk4/mergevcfs/meta.yml
@ -35,6 +35,11 @@ output:
      type: file
      description: merged vcf file
      pattern: "*.vcf.gz"
+  - tbi:
+      type: file
+      description: index files for the merged vcf files
+      pattern: "*.tbi"
+
  - versions:
      type: file
      description: File containing software versions
--- a/modules/kat/hist/main.nf
+++ b/modules/kat/hist/main.nf
@ -0,0 +1,42 @@
+process KAT_HIST {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda (params.enable_conda ? "bioconda::kat=2.4.2" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/kat:2.4.2--py38hfc5f9d8_2':
+        'quay.io/biocontainers/kat:2.4.2--py38hfc5f9d8_2' }"
+
+    input:
+    tuple val(meta), path(reads)
+
+    output:
+    tuple val(meta), path("*.hist")                   , emit: hist
+    tuple val(meta), path("*.hist.dist_analysis.json"), emit: json
+    tuple val(meta), path("*.png")                    , emit: png           , optional: true
+    tuple val(meta), path("*.ps")                     , emit: ps            , optional: true
+    tuple val(meta), path("*.pdf")                    , emit: pdf           , optional: true
+    tuple val(meta), path("*-hash.jf*")               , emit: jellyfish_hash, optional: true
+    path "versions.yml"                               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    kat hist \\
+        --threads $task.cpus \\
+        --output_prefix ${prefix}.hist \\
+        $args \\
+        $reads
+
+    ls -l
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        kat: \$( kat hist --version | sed 's/kat //' )
+    END_VERSIONS
+    """
+}
--- a/modules/kat/hist/meta.yml
+++ b/modules/kat/hist/meta.yml
@ -0,0 +1,64 @@
+name: "kat_hist"
+description: Creates a histogram of the number of distinct k-mers having a given frequency.
+keywords:
+  - k-mer
+  - histogram
+  - count
+tools:
+  - "kat":
+      description: "KAT is a suite of tools that analyse jellyfish hashes or sequence files (fasta or fastq) using kmer counts"
+      homepage: https://www.earlham.ac.uk/kat-tools
+      documentation: https://kat.readthedocs.io/en/latest/index.html
+      tool_dev_url: https://github.com/TGAC/KAT
+      doi: http://bioinformatics.oxfordjournals.org/content/early/2016/10/20/bioinformatics.btw663.abstract
+      licence: "['GPL v3']"
+
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: file
+      description: |
+        List of input FastQ files of size 1 and 2 for single-end and paired-end data,
+        respectively.
+
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - hist:
+      type: file
+      description: KAT histogram of k-mer counts
+      pattern: "*.hist"
+  - json:
+      type: file
+      description: KAT histogram summary of distance analysis
+      pattern: "*.hist.dist_analysis.json"
+  - png:
+      type: file
+      description: KAT plot of k-mer histogram in PNG format
+      pattern: "*.png"
+  - ps:
+      type: file
+      description: KAT plot of k-mer histogram in PS format
+      pattern: "*.ps"
+  - pdf:
+      type: file
+      description: KAT plot of k-mer histogram in PDF format
+      pattern: "*.pdf"
+  - jellyfish_hash:
+      type: file
+      description: Jellyfish hash file
+      pattern: "*-hist.jf*"
+
+authors:
+  - "@mahesh-panchal"
--- a/modules/mash/screen/main.nf
+++ b/modules/mash/screen/main.nf
@ -8,8 +8,8 @@ process MASH_SCREEN {
        'quay.io/biocontainers/mash:2.3--he348c14_1' }"

    input:
-    tuple val(meta), path(query_sketch)
-    path fastx_db
+    tuple val(meta), path(query)
+    path sequences_sketch

    output:
    tuple val(meta), path("*.screen"), emit: screen
@ -26,8 +26,8 @@ process MASH_SCREEN {
        screen \\
        $args \\
        -p $task.cpus \\
-        $query_sketch \\
-        $fastx_db \\
+        $sequences_sketch \\
+        $query \\
        > ${prefix}.screen

    cat <<-END_VERSIONS > versions.yml
--- a/modules/mash/screen/meta.yml
+++ b/modules/mash/screen/meta.yml
@ -20,13 +20,14 @@ input:
      description: |
        Groovy Map containing sample information
        e.g. [ id:'test', single_end:false ]
-  - query_sketch:
+  - query:
      type: file
-      description: MinHash sketch of query sequences
-      pattern: "*.msh"
-  - fastx_db:
+      description: Query sequences
+      pattern: "*.fastq.gz"
+  - sequence_sketch:
      type: file
      description: Sequence files to match against
+      pattern: "*.msh"

 output:
  - meta:
--- a/modules/mosdepth/main.nf
+++ b/modules/mosdepth/main.nf
@ -10,18 +10,22 @@ process MOSDEPTH {
    input:
    tuple val(meta), path(bam), path(bai)
    path  bed
-    val   window_size
+    path  fasta

    output:
-    tuple val(meta), path('*.global.dist.txt')    , emit: global_txt
-    tuple val(meta), path('*.region.dist.txt')    , emit: regions_txt , optional:true
-    tuple val(meta), path('*.summary.txt')        , emit: summary_txt
-    tuple val(meta), path('*.per-base.d4')        , emit: d4          , optional:true
-    tuple val(meta), path('*.per-base.bed.gz')    , emit: per_base_bed, optional:true
-    tuple val(meta), path('*.per-base.bed.gz.csi'), emit: per_base_csi, optional:true
-    tuple val(meta), path('*.regions.bed.gz')     , emit: regions_bed , optional:true
-    tuple val(meta), path('*.regions.bed.gz.csi') , emit: regions_csi , optional:true
-    path  "versions.yml"                          , emit: versions
+    tuple val(meta), path('*.global.dist.txt')      , emit: global_txt
+    tuple val(meta), path('*.summary.txt')          , emit: summary_txt
+    tuple val(meta), path('*.region.dist.txt')      , optional:true, emit: regions_txt
+    tuple val(meta), path('*.per-base.d4')          , optional:true, emit: per_base_d4
+    tuple val(meta), path('*.per-base.bed.gz')      , optional:true, emit: per_base_bed
+    tuple val(meta), path('*.per-base.bed.gz.csi')  , optional:true, emit: per_base_csi
+    tuple val(meta), path('*.regions.bed.gz')       , optional:true, emit: regions_bed
+    tuple val(meta), path('*.regions.bed.gz.csi')   , optional:true, emit: regions_csi
+    tuple val(meta), path('*.quantized.bed.gz')     , optional:true, emit: quantized_bed
+    tuple val(meta), path('*.quantized.bed.gz.csi') , optional:true, emit: quantized_csi
+    tuple val(meta), path('*.thresholds.bed.gz')    , optional:true, emit: thresholds_bed
+    tuple val(meta), path('*.thresholds.bed.gz.csi'), optional:true, emit: thresholds_csi
+    path  "versions.yml"                            , emit: versions

    when:
    task.ext.when == null || task.ext.when
@ -29,19 +33,24 @@ process MOSDEPTH {
    script:
    def args = task.ext.args ?: ''
    def prefix = task.ext.prefix ?: "${meta.id}"
-    if (window_size) {
-        interval = "--by ${window_size}"
-    } else if ( bed ) {
-        interval = "--by ${bed}"
-    } else {
-        interval = ""
+    def reference = fasta ? "--fasta ${fasta}" : ""
+    def interval = bed ? "--by ${bed}" : ""
+    if (bed && args.contains("--by")) {
+        exit 1, "'--by' can only be specified once when running mosdepth! Either remove input BED file definition or remove '--by' from 'ext.args' definition"
    }
+    if (!bed && args.contains("--thresholds")) {
+        exit 1, "'--thresholds' can only be specified in conjunction with '--by'"
+    }
+
    """
    mosdepth \\
+        --threads $task.cpus \\
        $interval \\
+        $reference \\
        $args \\
        $prefix \\
        $bam
+
    cat <<-END_VERSIONS > versions.yml
    "${task.process}":
        mosdepth: \$(mosdepth --version 2>&1 | sed 's/^.*mosdepth //; s/ .*\$//')
@ -59,6 +68,10 @@ process MOSDEPTH {
    touch ${prefix}.per-base.bed.gz.csi
    touch ${prefix}.regions.bed.gz
    touch ${prefix}.regions.bed.gz.csi
+    touch ${prefix}.quantized.bed.gz
+    touch ${prefix}.quantized.bed.gz.csi
+    touch ${prefix}.thresholds.bed.gz
+    touch ${prefix}.thresholds.bed.gz.csi

    cat <<-END_VERSIONS > versions.yml
    "${task.process}":
--- a/modules/mosdepth/meta.yml
+++ b/modules/mosdepth/meta.yml
@ -30,10 +30,10 @@ input:
      type: file
      description: BED file with intersected intervals
      pattern: "*.{bed}"
-  - window_size:
-      type: integer
-      description: Window size
-      pattern: "[0-9]+"
+  - fasta:
+      type: file
+      description: Reference genome FASTA file
+      pattern: "*.{fa,fasta}"
 output:
  - meta:
      type: map
@ -60,6 +60,10 @@ output:
      type: file
      description: Index file for BED file with per-base coverage
      pattern: "*.{per-base.bed.gz.csi}"
+  - per_base_d4:
+      type: file
+      description: D4 file with per-base coverage
+      pattern: "*.{per-base.d4}"
  - regions_bed:
      type: file
      description: BED file with per-region coverage
@ -68,6 +72,22 @@ output:
      type: file
      description: Index file for BED file with per-region coverage
      pattern: "*.{regions.bed.gz.csi}"
+  - quantized_bed:
+      type: file
+      description: BED file with binned coverage
+      pattern: "*.{quantized.bed.gz}"
+  - quantized_csi:
+      type: file
+      description: Index file for BED file with binned coverage
+      pattern: "*.{quantized.bed.gz.csi}"
+  - thresholds_bed:
+      type: file
+      description: BED file with the number of bases in each region that are covered at or above each threshold
+      pattern: "*.{thresholds.bed.gz}"
+  - thresholds_csi:
+      type: file
+      description: Index file for BED file with threshold coverage
+      pattern: "*.{thresholds.bed.gz.csi}"
  - versions:
      type: file
      description: File containing software versions
@ -76,3 +96,4 @@ authors:
  - "@joseespinosa"
  - "@drpatelh"
  - "@ramprasadn"
+  - "@matthdsm"
--- a/modules/star/align/main.nf
+++ b/modules/star/align/main.nf
@ -2,16 +2,15 @@ process STAR_ALIGN {
    tag "$meta.id"
    label 'process_high'

-    // Note: 2.7X indices incompatible with AWS iGenomes.
-    conda (params.enable_conda ? 'bioconda::star=2.7.9a' : null)
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/star:2.7.9a--h9ee0642_0' :
-        'quay.io/biocontainers/star:2.7.9a--h9ee0642_0' }"
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"

    input:
    tuple val(meta), path(reads)
-    path  index
-    path  gtf
+    path index
+    path gtf
    val star_ignore_sjdbgtf
    val seq_platform
    val seq_center
@ -67,6 +66,8 @@ process STAR_ALIGN {
    cat <<-END_VERSIONS > versions.yml
    "${task.process}":
        star: \$(STAR --version | sed -e "s/STAR_//g")
+        samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+        gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
    END_VERSIONS
    """
 }
--- a/modules/star/genomegenerate/main.nf
+++ b/modules/star/genomegenerate/main.nf
@ -2,19 +2,18 @@ process STAR_GENOMEGENERATE {
    tag "$fasta"
    label 'process_high'

-    // Note: 2.7X indices incompatible with AWS iGenomes.
-    conda (params.enable_conda ? "bioconda::star=2.7.9a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
+    conda (params.enable_conda ? "bioconda::star=2.7.10a bioconda::samtools=1.15.1 conda-forge::gawk=5.1.0" : null)
    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' :
-        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1c4c32d87798d425c970ececfbadd155e7560277-0' }"
+        'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' :
+        'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:afaaa4c6f5b308b4b6aa2dd8e99e1466b2a6b0cd-0' }"

    input:
    path fasta
    path gtf

    output:
-    path "star"         , emit: index
-    path "versions.yml" , emit: versions
+    path "star"        , emit: index
+    path "versions.yml", emit: versions

    when:
    task.ext.when == null || task.ext.when
@ -22,7 +21,7 @@ process STAR_GENOMEGENERATE {
    script:
    def args = task.ext.args ?: ''
    def args_list = args.tokenize()
-    def memory   = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
+    def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : ''
    if (args_list.contains('--genomeSAindexNbases')) {
        """
        mkdir star
--- a/modules/umitools/dedup/main.nf
+++ b/modules/umitools/dedup/main.nf
@ -9,12 +9,13 @@ process UMITOOLS_DEDUP {

    input:
    tuple val(meta), path(bam), path(bai)
+    val get_output_stats

    output:
    tuple val(meta), path("*.bam")             , emit: bam
-    tuple val(meta), path("*edit_distance.tsv"), emit: tsv_edit_distance
-    tuple val(meta), path("*per_umi.tsv")      , emit: tsv_per_umi
-    tuple val(meta), path("*per_position.tsv") , emit: tsv_umi_per_position
+    tuple val(meta), path("*edit_distance.tsv"), optional:true, emit: tsv_edit_distance
+    tuple val(meta), path("*per_umi.tsv")      , optional:true, emit: tsv_per_umi
+    tuple val(meta), path("*per_position.tsv") , optional:true, emit: tsv_umi_per_position
    path  "versions.yml"                       , emit: versions

    when:
@ -24,12 +25,13 @@ process UMITOOLS_DEDUP {
    def args = task.ext.args ?: ''
    def prefix = task.ext.prefix ?: "${meta.id}"
    def paired = meta.single_end ? "" : "--paired"
+    def stats = get_output_stats ? "--output-stats $prefix" : ""
    """
    umi_tools \\
        dedup \\
        -I $bam \\
        -S ${prefix}.bam \\
-        --output-stats $prefix \\
+        $stats \\
        $paired \\
        $args

--- a/modules/umitools/dedup/meta.yml
+++ b/modules/umitools/dedup/meta.yml
@ -26,6 +26,10 @@ input:
    description: |
      BAM index files corresponding to the input BAM file.
    pattern: "*.{bai}"
+  - get_output_stats:
+    type: boolean
+    description: |
+      Whether or not to generate output stats.
 output:
  - meta:
    type: map
--- a/modules/vsearch/usearchglobal/main.nf
+++ b/modules/vsearch/usearchglobal/main.nf
@ -0,0 +1,67 @@
+process VSEARCH_USEARCHGLOBAL {
+    tag "${meta.id}"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::vsearch=2.21.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/vsearch:2.21.1--h95f258a_0':
+        'quay.io/biocontainers/vsearch:2.21.1--h95f258a_0' }"
+
+    input:
+    tuple val(meta), path(queryfasta)
+    path db
+    val idcutoff
+    val outoption
+    val user_columns
+
+    output:
+    tuple val(meta), path('*.aln')    , optional: true, emit: aln
+    tuple val(meta), path('*.biom')   , optional: true, emit: biom
+    tuple val(meta), path('*.lca')    , optional: true, emit: lca
+    tuple val(meta), path('*.mothur') , optional: true, emit: mothur
+    tuple val(meta), path('*.otu')    , optional: true, emit: otu
+    tuple val(meta), path('*.sam')    , optional: true, emit: sam
+    tuple val(meta), path('*.tsv')    , optional: true, emit: tsv
+    tuple val(meta), path('*.txt')    , optional: true, emit: txt
+    tuple val(meta), path('*.uc')     , optional: true, emit: uc
+    path "versions.yml"                               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def columns = user_columns ? "--userfields ${user_columns}" : ''
+    switch ( outoption ) {
+        case "alnout": outfmt = "--alnout"; out_ext = 'aln'; break
+        case "biomout": outfmt = "--biomout"; out_ext = 'biom'; break
+        case "blast6out": outfmt = "--blast6out"; out_ext = 'txt'; break
+        case "mothur_shared_out": outfmt = "--mothur_shared_out"; out_ext = 'mothur'; break
+        case "otutabout": outfmt = "--otutabout"; out_ext = 'otu'; break
+        case "samout": outfmt = "--samout"; out_ext = 'sam'; break
+        case "uc": outfmt = "--uc"; out_ext = 'uc'; break
+        case "userout": outfmt = "--userout"; out_ext = 'tsv'; break
+        case "lcaout": outfmt = "--lcaout"; out_ext = 'lca'; break
+        default:
+            outfmt = "--alnout";
+            out_ext = 'aln';
+            log.warn("Unknown output file format provided (${outoption}): selecting pairwise alignments (alnout)");
+            break
+    }
+    """
+    vsearch \\
+        --usearch_global $queryfasta \\
+        --db $db \\
+        --id $idcutoff \\
+        --threads $task.cpus \\
+        $args \\
+        ${columns} \\
+        ${outfmt} ${prefix}.${out_ext}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        vsearch: \$(vsearch --version 2>&1 | head -n 1 | sed 's/vsearch //g' | sed 's/,.*//g' | sed 's/^v//' | sed 's/_.*//')
+    END_VERSIONS
+    """
+}
--- a/modules/vsearch/usearchglobal/meta.yml
+++ b/modules/vsearch/usearchglobal/meta.yml
@ -0,0 +1,83 @@
+name: "vsearch_usearchglobal"
+description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment.
+keywords:
+  - vsearch
+  - usearch
+  - alignment
+  - fasta
+tools:
+  - "vsearch":
+      description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)"
+      homepage: "https://github.com/torognes/vsearch"
+      documentation: "None"
+      tool_dev_url: "https://github.com/torognes/vsearch"
+      doi: "doi: 10.7717/peerj.2584"
+      licence: "['GPL v3-or-later OR BSD-2-clause']"
+
+input:
+  - meta:
+      type: map
+      description: Groovy Map containing sample information e.g. [ id:'test' ]
+  - queryfasta:
+      type: file
+      description: Query sequences in FASTA format
+      pattern: "*.{fasta,fa,fna,faa}"
+  - db:
+      type: file
+      description: Reference database file in FASTA or UDB format
+      pattern: "*"
+  - idcutoff:
+      type: real
+      description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included)
+  - outoption:
+      type: string
+      description: Specify the type of output file to be generated by selecting one of the vsearch output file options
+      pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout"
+  - user_columns:
+      type: string
+      description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string.
+
+output:
+  - aln:
+      type: file
+      description: Results in pairwise alignment format
+      pattern: "*.{aln}"
+  - biom:
+      type: file
+      description: Results in an OTU table in the biom version 1.0 file format
+      pattern: "*.{biom}"
+  - lca:
+      type: file
+      description: Last common ancestor (LCA) information about the hits of each query in tab-separated format
+      pattern: "*.{lca}"
+  - mothur:
+      type: file
+      description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format
+      pattern: "*.{mothur}"
+  - otu:
+      type: file
+      description: Results in an OTU table in the classic tab-separated plain text format
+      pattern: "*.{otu}"
+  - sam:
+      type: file
+      description: Results written in sam format
+      pattern: "*.{sam}"
+  - tsv:
+      type: file
+      description: Results in tab-separated output, columns defined by user
+      pattern: "*.{tsv}"
+  - txt:
+      type: file
+      description: Tab delimited results in blast-like tabular format
+      pattern: "*.{txt}"
+  - uc:
+      type: file
+      description: Tab delimited results in a uclust-like format with 10 columns
+      pattern: "*.{uc}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+
+authors:
+  - "@jtangrot"
--- a/tests/config/pytest_modules.yml
+++ b/tests/config/pytest_modules.yml
@ -166,6 +166,10 @@ bcftools/reheader:
  - modules/bcftools/reheader/**
  - tests/modules/bcftools/reheader/**

+bcftools/roh:
+  - modules/bcftools/roh/**
+  - tests/modules/bcftools/roh/**
+
 bcftools/sort:
  - modules/bcftools/sort/**
  - tests/modules/bcftools/sort/**
@ -455,6 +459,10 @@ cnvkit/batch:
  - modules/cnvkit/batch/**
  - tests/modules/cnvkit/batch/**

+cnvkit/reference:
+  - modules/cnvkit/reference/**
+  - tests/modules/cnvkit/reference/**
+
 controlfreec/assesssignificance:
  - modules/controlfreec/assesssignificance/**
  - tests/modules/controlfreec/assesssignificance/**
@ -703,9 +711,9 @@ freebayes:
  - modules/freebayes/**
  - tests/modules/freebayes/**

-gamma:
-  - modules/gamma/**
-  - tests/modules/gamma/**
+gamma/gamma:
+  - modules/gamma/gamma/**
+  - tests/modules/gamma/gamma/**

 gatk4/applybqsr:
  - modules/gatk4/applybqsr/**
@ -743,6 +751,10 @@ gatk4/combinegvcfs:
  - modules/gatk4/combinegvcfs/**
  - tests/modules/gatk4/combinegvcfs/**

+gatk4/composestrtablefile:
+  - modules/gatk4/composestrtablefile/**
+  - tests/modules/gatk4/composestrtablefile/**
+
 gatk4/createsequencedictionary:
  - modules/gatk4/createsequencedictionary/**
  - tests/modules/gatk4/createsequencedictionary/**
@ -1085,6 +1097,10 @@ kallistobustools/ref:
  - modules/kallistobustools/ref/**
  - tests/modules/kallistobustools/ref/**

+kat/hist:
+  - modules/kat/hist/**
+  - tests/modules/kat/hist/**
+
 khmer/normalizebymedian:
  - modules/khmer/normalizebymedian/**
  - tests/modules/khmer/normalizebymedian/**
@ -2040,6 +2056,10 @@ vcftools:
  - modules/vcftools/**
  - tests/modules/vcftools/**

+vsearch/usearchglobal:
+  - modules/vsearch/usearchglobal/**
+  - tests/modules/vsearch/usearchglobal/**
+
 yara/index:
  - modules/yara/index/**
  - tests/modules/yara/index/**
--- a/tests/config/test_data.config
+++ b/tests/config/test_data.config
@ -144,6 +144,7 @@ params {
                genome_21_sizes                                = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/genome.sizes"
                genome_21_interval_list                        = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/genome.interval_list"
                genome_21_multi_interval_bed                   = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed"
+                genome_21_multi_interval_antitarget_bed        = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.antitarget.bed"
                genome_21_multi_interval_bed_gz                = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz"
                genome_21_multi_interval_bed_gz_tbi            = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/multi_intervals.bed.gz.tbi"
                genome_21_chromosomes_dir                      = "${test_data_dir}/genomics/homo_sapiens/genome/chr21/sequence/chromosomes.tar.gz"
--- a/tests/modules/bcftools/concat/main.nf
+++ b/tests/modules/bcftools/concat/main.nf
@ -4,13 +4,25 @@ nextflow.enable.dsl = 2

 include { BCFTOOLS_CONCAT } from '../../../../modules/bcftools/concat/main.nf'

-workflow test_bcftools_concat {
+workflow test_bcftools_concat_tbi {
    
    input = [ [ id:'test3' ], // meta map
              [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
-                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ]
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
+              [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true),
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz_tbi'], checkIfExists: true) ]
+            ]
+
+    BCFTOOLS_CONCAT ( input )
+}
+
+workflow test_bcftools_concat_no_tbi {
+    
+    input = [ [ id:'test3' ], // meta map
+              [ file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+                file(params.test_data['sarscov2']['illumina']['test2_vcf_gz'], checkIfExists: true) ],
+              []
            ]

-
    BCFTOOLS_CONCAT ( input )
 }
--- a/tests/modules/bcftools/concat/test.yml
+++ b/tests/modules/bcftools/concat/test.yml
@ -1,8 +1,17 @@
- name: bcftools concat test_bcftools_concat
-  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/concat/nextflow.config
+- name: bcftools concat test_bcftools_concat_tbi
+  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_tbi -c ./tests/config/nextflow.config  -c ./tests/modules/bcftools/concat/nextflow.config
  tags:
-    - bcftools/concat
    - bcftools
+    - bcftools/concat
+  files:
+    - path: output/bcftools/test3.vcf.gz
+      md5sum: 35c88bfaad20101062e98beb217d7137
+
+- name: bcftools concat test_bcftools_concat_no_tbi
+  command: nextflow run ./tests/modules/bcftools/concat -entry test_bcftools_concat_no_tbi -c ./tests/config/nextflow.config  -c ./tests/modules/bcftools/concat/nextflow.config
+  tags:
+    - bcftools
+    - bcftools/concat
  files:
    - path: output/bcftools/test3.vcf.gz
      md5sum: 35c88bfaad20101062e98beb217d7137
--- a/tests/modules/bcftools/roh/main.nf
+++ b/tests/modules/bcftools/roh/main.nf
@ -0,0 +1,35 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { BCFTOOLS_ROH } from '../../../../modules/bcftools/roh/main.nf'
+
+workflow test_bcftools_roh {
+
+    input = [ [ id:'test' ], // meta map
+             file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+             file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true)]
+
+    af_file = []
+    gen_map = []
+    regions = []
+    targets = []
+    samples = []
+
+    BCFTOOLS_ROH ( input, af_file, gen_map, regions, samples, targets )
+}
+
+workflow test_bcftools_roh_stub {
+
+    input = [ [ id:'test' ], // meta map
+             file(params.test_data['sarscov2']['illumina']['test_vcf_gz'], checkIfExists: true),
+             file(params.test_data['sarscov2']['illumina']['test_vcf_gz_tbi'], checkIfExists: true)]
+
+    af_file = []
+    gen_map = []
+    regions = []
+    targets = []
+    samples = []
+
+    BCFTOOLS_ROH ( input, af_file, gen_map, regions, samples, targets )
+}
--- a/tests/modules/bcftools/roh/nextflow.config
+++ b/tests/modules/bcftools/roh/nextflow.config
@ -0,0 +1,5 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+
+}
--- a/tests/modules/bcftools/roh/test.yml
+++ b/tests/modules/bcftools/roh/test.yml
@ -0,0 +1,17 @@
+- name: "bcftools roh"
+  command: nextflow run ./tests/modules/bcftools/roh -entry test_bcftools_roh -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/roh/nextflow.config
+  tags:
+    - "bcftools"
+    - "bcftools/roh"
+  files:
+    - path: "output/bcftools/test.roh"
+    - path: "output/bcftools/versions.yml"
+
+- name: "bcftools roh stub"
+  command: nextflow run ./tests/modules/bcftools/roh -entry test_bcftools_roh_stub -c ./tests/config/nextflow.config -c ./tests/modules/bcftools/roh/nextflow.config
+  tags:
+    - "bcftools"
+    - "bcftools/roh"
+  files:
+    - path: "output/bcftools/test.roh"
+    - path: "output/bcftools/versions.yml"
--- a/tests/modules/cnvkit/reference/main.nf
+++ b/tests/modules/cnvkit/reference/main.nf
@ -0,0 +1,14 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { CNVKIT_REFERENCE } from '../../../../modules/cnvkit/reference/main.nf'
+
+workflow test_cnvkit_reference {
+
+    fasta       = file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true)
+    targets     = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_bed'], checkIfExists: true)
+    antitargets = file(params.test_data['homo_sapiens']['genome']['genome_21_multi_interval_antitarget_bed'], checkIfExists: true)
+
+    CNVKIT_REFERENCE ( fasta, targets, antitargets )
+}
--- a/tests/modules/cnvkit/reference/nextflow.config
+++ b/tests/modules/cnvkit/reference/nextflow.config
@ -0,0 +1,5 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}
--- a/tests/modules/cnvkit/reference/test.yml
+++ b/tests/modules/cnvkit/reference/test.yml
@ -0,0 +1,8 @@
+- name: cnvkit reference test_cnvkit_reference
+  command: nextflow run ./tests/modules/cnvkit/reference -entry test_cnvkit_reference -c ./tests/config/nextflow.config  -c ./tests/modules/cnvkit/reference/nextflow.config
+  tags:
+    - cnvkit/reference
+    - cnvkit
+  files:
+    - path: output/cnvkit/multi_intervals.reference.cnn
+      md5sum: 7c4a7902f5ab101b1f9d6038d331b3d9
--- a/tests/modules/filtlong/nextflow.config
+++ b/tests/modules/filtlong/nextflow.config
@ -2,4 +2,7 @@ process {

    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }

+    ext.args = "--min_length 10"
+    ext.prefix = "test_lr"
+
 }
--- a/tests/modules/filtlong/test.yml
+++ b/tests/modules/filtlong/test.yml
@ -1,23 +1,26 @@
 - name: filtlong test_filtlong
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
  tags:
    - filtlong
  files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+    - path: output/filtlong/test_lr.fastq.gz
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"

 - name: filtlong test_filtlong_illumina_se
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_se -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
  tags:
    - filtlong
  files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+    - path: output/filtlong/test_lr.fastq.gz
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"

 - name: filtlong test_filtlong_illumina_pe
-  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config -c ./tests/modules/filtlong/nextflow.config
+  command: nextflow run ./tests/modules/filtlong -entry test_filtlong_illumina_pe -c ./tests/config/nextflow.config  -c ./tests/modules/filtlong/nextflow.config
  tags:
    - filtlong
  files:
-    - path: output/filtlong/test_lr_filtlong.fastq.gz
-      md5sum: 7029066c27ac6f5ef18d660d5741979a
+    - path: output/filtlong/test_lr.fastq.gz
+      contains:
+        - "@00068f7a-51b3-4933-8fc6-7d6e29181ff9"
--- a/tests/modules/gamma/gamma/main.nf
+++ b/tests/modules/gamma/gamma/main.nf
@ -0,0 +1,29 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GAMMA_GAMMA } from '../../../../modules/gamma/gamma/main.nf'
+
+workflow test_unzip {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['bacteroides_fragilis']['illumina']['test1_contigs_fa_gz'], checkIfExists: true),
+    ]
+
+    db = [ file("https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/delete_me/srst2/ResGANNCBI_20210507_srst2.fasta", checkIfExists: true), ]
+
+    GAMMA_GAMMA ( input, db )
+}
+
+workflow test_gamma {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    ]
+
+    db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
+
+    GAMMA_GAMMA ( input, db )
+}
--- a/tests/modules/gamma/gamma/nextflow.config
+++ b/tests/modules/gamma/gamma/nextflow.config
--- a/tests/modules/gamma/gamma/test.yml
+++ b/tests/modules/gamma/gamma/test.yml
@ -0,0 +1,29 @@
+- name: gamma gamma test_unzip
+  command: nextflow run tests/modules/gamma/gamma -entry test_unzip -c tests/config/nextflow.config
+  tags:
+    - gamma/gamma
+    - gamma
+  files:
+    - path: output/gamma/test.fasta
+      md5sum: 5b3b831d863fffaa3410a9ee7bfa12ce
+    - path: output/gamma/test.gamma
+      md5sum: 46165a89e10b7315d3a9b0aa6c561626
+    - path: output/gamma/test.psl
+      md5sum: f489ce4602ddbcb692d5781ee3fbf449
+    - path: output/gamma/versions.yml
+      md5sum: 8baafec7b3b87f788f69e30d317c9722
+
+- name: gamma gamma test_gamma
+  command: nextflow run tests/modules/gamma/gamma -entry test_gamma -c tests/config/nextflow.config
+  tags:
+    - gamma/gamma
+    - gamma
+  files:
+    - path: output/gamma/test.fasta
+      md5sum: df37b48466181311e0a679f3c5878484
+    - path: output/gamma/test.gamma
+      md5sum: 3256708fa517a65ed01d99e0e3c762ae
+    - path: output/gamma/test.psl
+      md5sum: 162a2757ed3b167ae1e0cdb24213f940
+    - path: output/gamma/versions.yml
+      md5sum: b75c2871d8cac2f8ac67c0fbd22babd6
--- a/tests/modules/gamma/main.nf
+++ b/tests/modules/gamma/main.nf
@ -1,17 +0,0 @@
-#!/usr/bin/env nextflow
-
-nextflow.enable.dsl = 2
-
-include { GAMMA } from '../../../modules/gamma/main.nf'
-
-workflow test_gamma {
-    
-    input = [
-        [ id:'test', single_end:false ], // meta map
-        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
-    ]
-
-    db = [ file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true) ]
-
-    GAMMA ( input, db )
-}
--- a/tests/modules/gamma/test.yml
+++ b/tests/modules/gamma/test.yml
@ -1,13 +0,0 @@
- name: gamma test_gamma
-  command: nextflow run tests/modules/gamma -entry test_gamma -c tests/config/nextflow.config
-  tags:
-    - gamma
-  files:
-    - path: output/gamma/test.fasta
-      md5sum: df37b48466181311e0a679f3c5878484
-    - path: output/gamma/test.gamma
-      md5sum: 3256708fa517a65ed01d99e0e3c762ae
-    - path: output/gamma/test.psl
-      md5sum: 162a2757ed3b167ae1e0cdb24213f940
-    - path: output/gamma/versions.yml
-      md5sum: 3fefb5b46c94993362243c5f9a472057
--- a/tests/modules/gatk4/composestrtablefile/main.nf
+++ b/tests/modules/gatk4/composestrtablefile/main.nf
@ -0,0 +1,16 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GATK4_COMPOSESTRTABLEFILE } from '../../../../modules/gatk4/composestrtablefile/main.nf'
+
+workflow test_gatk4_composestrtablefile {
+    
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    fasta_fai = file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true)
+
+    dict = file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true)
+
+    GATK4_COMPOSESTRTABLEFILE ( fasta, fasta_fai, dict )
+}
--- a/tests/modules/gatk4/composestrtablefile/nextflow.config
+++ b/tests/modules/gatk4/composestrtablefile/nextflow.config
@ -0,0 +1,5 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+    
+}
--- a/tests/modules/gatk4/composestrtablefile/test.yml
+++ b/tests/modules/gatk4/composestrtablefile/test.yml
@ -0,0 +1,7 @@
+- name: gatk4 composestrtablefile test_gatk4_composestrtablefile
+  command: nextflow run ./tests/modules/gatk4/composestrtablefile -entry test_gatk4_composestrtablefile -c ./tests/config/nextflow.config  -c ./tests/modules/gatk4/composestrtablefile/nextflow.config
+  tags:
+    - gatk4/composestrtablefile
+    - gatk4
+  files:
+    - path: output/gatk4/genome.zip
--- a/tests/modules/gatk4/mergevcfs/test.yml
+++ b/tests/modules/gatk4/mergevcfs/test.yml
@ -6,6 +6,8 @@
  files:
    - path: output/gatk4/test.vcf.gz
      md5sum: 5b289bda88d3a3504f2e19ee8cff177c
+    - path: output/gatk4/test.vcf.gz.tbi
+      md5sum: a81673763b13086cfce9a23e72a35a16
    - path: output/gatk4/versions.yml

 - name: gatk4 mergevcfs test_gatk4_mergevcfs_no_dict
--- a/tests/modules/kat/hist/main.nf
+++ b/tests/modules/kat/hist/main.nf
@ -0,0 +1,28 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { KAT_HIST } from '../../../../modules/kat/hist/main.nf'
+
+workflow test_kat_hist_single_end {
+
+    input = [
+        [ id:'test', single_end:true ], // meta map
+        file(params.test_data['homo_sapiens']['illumina']['test2_1_fastq_gz'], checkIfExists: true)
+    ]
+
+    KAT_HIST ( input )
+}
+
+workflow test_kat_hist_paired_end {
+
+    input = [
+        [ id:'test', single_end:false ], // meta map
+        [
+            file(params.test_data['homo_sapiens']['illumina']['test2_1_fastq_gz'], checkIfExists: true),
+            file(params.test_data['homo_sapiens']['illumina']['test2_2_fastq_gz'], checkIfExists: true),
+        ]
+    ]
+
+    KAT_HIST ( input )
+}
--- a/tests/modules/kat/hist/nextflow.config
+++ b/tests/modules/kat/hist/nextflow.config
@ -0,0 +1,9 @@
+process {
+
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+
+    withName: 'test_kat_hist_single_end:KAT_HIST' {
+        ext.args = '-d'
+    }
+
+}
--- a/tests/modules/kat/hist/test.yml
+++ b/tests/modules/kat/hist/test.yml
@ -0,0 +1,42 @@
+- name: kat hist test_kat_hist_single_end
+  command: nextflow run tests/modules/kat/hist -entry test_kat_hist_single_end -c tests/config/nextflow.config
+  tags:
+    - kat/hist
+    - kat
+  files:
+    - path: output/kat/test.hist
+      md5sum: c6eba52b3a2653a684577a8ae20b74c1
+    - path: output/kat/test.hist-hash.jf27
+    - path: output/kat/test.hist.dist_analysis.json
+      # md5sum: 52a5a2d91c71b940f36f1f0a7fd5ef10 # This is variable for an unknown reason
+      contains:
+        - "nb_peaks"
+        - "global_minima"
+        - "global_maxima"
+        - "mean_freq"
+        - "est_genome_size"
+        - "est_het_rate"
+    - path: output/kat/test.hist.png
+      md5sum: 49861ef1a265e0edde3550b39c64a274
+    - path: output/kat/versions.yml
+
+- name: kat hist test_kat_hist_paired_end
+  command: nextflow run tests/modules/kat/hist -entry test_kat_hist_paired_end -c tests/config/nextflow.config
+  tags:
+    - kat/hist
+    - kat
+  files:
+    - path: output/kat/test.hist
+      md5sum: 91429091e74b1718051591d83a1ccb5d
+    - path: output/kat/test.hist.dist_analysis.json
+      # md5sum: 8b0dabeaff4ba706b33aa8964d687e13  # This is variable for an unknown reason
+      contains:
+        - "nb_peaks"
+        - "global_minima"
+        - "global_maxima"
+        - "mean_freq"
+        - "est_genome_size"
+        - "est_het_rate"
+    - path: output/kat/test.hist.png
+      md5sum: e20774d0d2b979cb6ead7b7fb5ad36d9
+    - path: output/kat/versions.yml
--- a/tests/modules/mash/screen/main.nf
+++ b/tests/modules/mash/screen/main.nf
@ -14,8 +14,11 @@ workflow test_mash_screen {
            file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
        ]
    ]
-    fastx_db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    sars_db = [
+        [ id: 'sars_db' ],
+        file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    ]

-    MASH_SKETCH ( input )
-    MASH_SCREEN ( MASH_SKETCH.out.mash, fastx_db )
+    MASH_SKETCH ( sars_db )
+    MASH_SCREEN ( input, MASH_SKETCH.out.mash.map { meta, sketch -> sketch } )
 }
--- a/tests/modules/mash/screen/test.yml
+++ b/tests/modules/mash/screen/test.yml
@ -4,9 +4,9 @@
    - mash
    - mash/screen
  files:
-    - path: output/mash/test.mash_stats
-      md5sum: 2a6f297d8e69a5e4160243bc6c89129c
-    - path: output/mash/test.msh
-      md5sum: d747145a43dad5f82342036f8f5d9133
+    - path: output/mash/sars_db.mash_stats
+      md5sum: 1dafbd23e36e18bf4c87a007d0fc98f7
+    - path: output/mash/sars_db.msh
+      md5sum: 24289e4a13526e88eeb2abfca4a0f0a8
    - path: output/mash/test.screen
-      md5sum: d3c871dccd5cd57ab54781fa5c5d7278
+      md5sum: ac8701e1aab651b2f36c6380b1351b11
--- a/tests/modules/mosdepth/main.nf
+++ b/tests/modules/mosdepth/main.nf
@ -2,35 +2,95 @@

 nextflow.enable.dsl = 2

-include { MOSDEPTH } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH                       } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_FAIL      } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_WINDOW    } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_THRESHOLD } from '../../../modules/mosdepth/main.nf'
+include { MOSDEPTH as MOSDEPTH_QUANTIZED } from '../../../modules/mosdepth/main.nf'

 workflow test_mosdepth {
-    input  = [ [ id:'test', single_end:true ],
-               [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-               [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-             ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]

    MOSDEPTH ( input, [], [] )
 }

-
-workflow test_mosdepth_window {
-    input  = [ [ id:'test', single_end:true ],
-               [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-               [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-             ]
-    window = 100
-
-    MOSDEPTH ( input, [], window )
-}
-
-
 workflow test_mosdepth_bed {
-    input  = [ [ id:'test', single_end:true ],
-               [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-               [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-             ]
-    bed  = [ file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true) ]
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)

    MOSDEPTH ( input, bed, [] )
 }
+
+workflow test_mosdepth_cram {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
+    ]
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    MOSDEPTH ( input, [], fasta )
+}
+
+workflow test_mosdepth_cram_bed {
+    input  = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+    fasta = file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)
+
+    MOSDEPTH ( input, bed, fasta )
+}
+
+workflow test_mosdepth_window {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+
+    MOSDEPTH_WINDOW ( input, [], [] )
+}
+
+workflow test_mosdepth_quantized {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+
+    MOSDEPTH_QUANTIZED ( input, [], [] )
+}
+
+workflow test_mosdepth_thresholds {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+
+    MOSDEPTH_THRESHOLD ( input, bed, [] )
+}
+
+workflow test_mosdepth_fail {
+    input = [
+        [ id:'test', single_end:true ],
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    bed = file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true)
+
+    MOSDEPTH_FAIL ( input, bed, [] )
+}
--- a/tests/modules/mosdepth/nextflow.config
+++ b/tests/modules/mosdepth/nextflow.config
@ -1,5 +1,16 @@
 process {

    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
-
+    withName: MOSDEPTH_FAIL {
+        ext.args = "--by 100"
+    }
+    withName: MOSDEPTH_WINDOW {
+        ext.args = "--by 100"
+    }
+    withName: MOSDEPTH_QUANTIZED {
+        ext.args = "--quantize 0:1:4:100:200"
+    }
+    withName: MOSDEPTH_THRESHOLD {
+        ext.args = "--thresholds 1,10,20,30"
+    }
 }
--- a/tests/modules/mosdepth/test.yml
+++ b/tests/modules/mosdepth/test.yml
@ -1,53 +1,135 @@
- name: mosdepth
-  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
+- name: mosdepth test_mosdepth
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
  tags:
    - mosdepth
  files:
-    - path: ./output/mosdepth/test.per-base.bed.gz.csi
-      md5sum: b2aad62c41a7146680d31df505fcc8c5
-    - path: ./output/mosdepth/test.per-base.bed.gz
-      md5sum: 11b3f649072c2c7453febb085b1a9c33
-    - path: ./output/mosdepth/test.mosdepth.global.dist.txt
-      md5sum: 2a1de1b0ecc361a21cd296ec4e1efd6a
-    - path: ./output/mosdepth/test.mosdepth.summary.txt
-      md5sum: 7b249dd3b3e58cc122fbd25ea84aa25d
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 4f0d231060cbde4efdd673863bd2fb59
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4

- name: mosdepth window
-  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_window -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
+- name: mosdepth test_mosdepth_bed
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_bed -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
  tags:
    - mosdepth
  files:
-    - path: ./output/mosdepth/test.per-base.bed.gz.csi
-      md5sum: b2aad62c41a7146680d31df505fcc8c5
-    - path: ./output/mosdepth/test.per-base.bed.gz
-      md5sum: 11b3f649072c2c7453febb085b1a9c33
-    - path: ./output/mosdepth/test.mosdepth.global.dist.txt
-      md5sum: 2a1de1b0ecc361a21cd296ec4e1efd6a
-    - path: ./output/mosdepth/test.regions.bed.gz
-      md5sum: 64e1ced01c4443d7c1796ef553992f0c
-    - path: ./output/mosdepth/test.regions.bed.gz.csi
-      md5sum: 9e312b4b0784bd46dfbd23b3a8afed6a
-    - path: ./output/mosdepth/test.mosdepth.region.dist.txt
-      md5sum: 65fbc824c4212c6884354d8ac72ad37e
-    - path: ./output/mosdepth/test.mosdepth.summary.txt
-      md5sum: 11804907dab069ddb99ca97bf2698572
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.region.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 96c037f769974b904beb53edc4f56d82
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.regions.bed.gz
+      md5sum: 5d398caf7171ec4406278e2add3009ae
+    - path: output/mosdepth/test.regions.bed.gz.csi
+      md5sum: 47669cfe41f3e222e74d81e1b1be191f

- name: mosdepth bed
-  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_bed -c ./tests/config/nextflow.config -c ./tests/modules/mosdepth/nextflow.config
+- name: mosdepth test_mosdepth_cram
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_cram -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
  tags:
    - mosdepth
  files:
-    - path: ./output/mosdepth/test.per-base.bed.gz.csi
-      md5sum: b2aad62c41a7146680d31df505fcc8c5
-    - path: ./output/mosdepth/test.per-base.bed.gz
-      md5sum: 11b3f649072c2c7453febb085b1a9c33
-    - path: ./output/mosdepth/test.mosdepth.global.dist.txt
-      md5sum: 2a1de1b0ecc361a21cd296ec4e1efd6a
-    - path: ./output/mosdepth/test.regions.bed.gz
-      md5sum: 347f877700d1dc42c95157199eff25d5
-    - path: ./output/mosdepth/test.regions.bed.gz.csi
-      md5sum: ed5fbf46e3bdcbf60094df295bc40356
-    - path: ./output/mosdepth/test.mosdepth.region.dist.txt
-      md5sum: 295564628113d2ec0ca34d7f661cfea8
-    - path: ./output/mosdepth/test.mosdepth.summary.txt
-      md5sum: b07817412fd17819c14541e63bc4926c
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 4f0d231060cbde4efdd673863bd2fb59
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+
+- name: mosdepth test_mosdepth_cram_bed
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_cram_bed -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.region.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 96c037f769974b904beb53edc4f56d82
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.regions.bed.gz
+      md5sum: 5d398caf7171ec4406278e2add3009ae
+    - path: output/mosdepth/test.regions.bed.gz.csi
+      md5sum: 47669cfe41f3e222e74d81e1b1be191f
+
+- name: mosdepth test_mosdepth_window
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_window -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.region.dist.txt
+      md5sum: 39e0e707ec32feb5176fd20a95f1f468
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 96c037f769974b904beb53edc4f56d82
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.regions.bed.gz
+      md5sum: f02e2cb49cc050e13d76942d6960827a
+    - path: output/mosdepth/test.regions.bed.gz.csi
+      md5sum: 257d67678136963d9dd904330079609d
+
+- name: mosdepth test_mosdepth_quantized
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_quantized -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 4f0d231060cbde4efdd673863bd2fb59
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.quantized.bed.gz
+      md5sum: 3e434a8bafcf59a67841ae3d4d752838
+    - path: output/mosdepth/test.quantized.bed.gz.csi
+      md5sum: be9617f551f19a33923f1e886eaefb93
+
+- name: mosdepth test_mosdepth_thresholds
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_thresholds -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  files:
+    - path: output/mosdepth/test.mosdepth.global.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.region.dist.txt
+      md5sum: e82e90c7d508a135b5a8a7cd6933452e
+    - path: output/mosdepth/test.mosdepth.summary.txt
+      md5sum: 96c037f769974b904beb53edc4f56d82
+    - path: output/mosdepth/test.per-base.bed.gz
+      md5sum: bc1df47d46f818fee5275975925d769a
+    - path: output/mosdepth/test.per-base.bed.gz.csi
+      md5sum: 9e649ac749ff6c6073bef5ab63e8aaa4
+    - path: output/mosdepth/test.regions.bed.gz
+      md5sum: 5d398caf7171ec4406278e2add3009ae
+    - path: output/mosdepth/test.regions.bed.gz.csi
+      md5sum: 47669cfe41f3e222e74d81e1b1be191f
+    - path: output/mosdepth/test.thresholds.bed.gz
+      md5sum: 13101e326eea3cbfa1d569b69f494f4c
+    - path: output/mosdepth/test.thresholds.bed.gz.csi
+      md5sum: 912055ee9452229439df6fae95644196
+
+- name: mosdepth test_mosdepth_fail
+  command: nextflow run ./tests/modules/mosdepth -entry test_mosdepth_fail -c ./tests/config/nextflow.config  -c ./tests/modules/mosdepth/nextflow.config
+  tags:
+    - mosdepth
+  exit_code: 1
--- a/tests/modules/star/align/test.yml
+++ b/tests/modules/star/align/test.yml
@ -36,7 +36,7 @@
    - path: output/star/star/transcriptInfo.tab
      md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
    - path: output/star/test.Aligned.out.bam
-      md5sum: b9f5e2f6a624b64c300fe25dc3ac801f
+      md5sum: 63de6af2210e138b49d7b4d570c6e67f
    - path: output/star/test.Log.final.out
    - path: output/star/test.Log.out
    - path: output/star/test.Log.progress.out
@ -80,7 +80,7 @@
    - path: output/star/star/transcriptInfo.tab
      md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
    - path: output/star/test.Aligned.out.bam
-      md5sum: 38d08f0b944a2a1b981a250d675aa0d9
+      md5sum: 7cdef439bc8092bfefb4d091bf8ee6ab
    - path: output/star/test.Log.final.out
    - path: output/star/test.Log.out
    - path: output/star/test.Log.progress.out
@ -124,7 +124,7 @@
    - path: output/star/star/transcriptInfo.tab
      md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
    - path: output/star/test.Aligned.out.bam
-      md5sum: c740d5177067c1fcc48ab7a16cd639d7
+      md5sum: 5dbc36fce7b72628c809bbc7d3d67973
    - path: output/star/test.Log.final.out
    - path: output/star/test.Log.out
    - path: output/star/test.Log.progress.out
@ -168,9 +168,9 @@
    - path: output/star/star/transcriptInfo.tab
      md5sum: 0c3a5adb49d15e5feff81db8e29f2e36
    - path: output/star/test.Aligned.out.bam
-      md5sum: a1bd1b40950a58ea2776908076160052
+      md5sum: d85858bf55a523121dde762046a34c5c
    - path: output/star/test.Chimeric.out.junction
-      md5sum: 327629eb54032212f29e1c32cbac6975
+      md5sum: ae87d1a24180f5a35cf6b47fdfdd0539
    - path: output/star/test.Log.final.out
    - path: output/star/test.Log.out
    - path: output/star/test.Log.progress.out
--- a/tests/modules/umitools/dedup/main.nf
+++ b/tests/modules/umitools/dedup/main.nf
@ -3,54 +3,81 @@
 nextflow.enable.dsl = 2

 include { UMITOOLS_EXTRACT } from '../../../../modules/umitools/extract/main.nf'
-include { BWA_INDEX } from '../../../../modules/bwa/index/main.nf'
-include { BWA_MEM   } from '../../../../modules/bwa/mem/main.nf'
+include { BWA_INDEX        } from '../../../../modules/bwa/index/main.nf'
+include { BWA_MEM          } from '../../../../modules/bwa/mem/main.nf'
 include { SAMTOOLS_INDEX   } from '../../../../modules/samtools/index/main.nf'
-include { UMITOOLS_DEDUP } from '../../../../modules/umitools/dedup/main.nf'
+include { UMITOOLS_DEDUP   } from '../../../../modules/umitools/dedup/main.nf'

 //
 // Test with no UMI
 //
 workflow test_umitools_dedup_no_umi {
-    input = [ [ id:'test'], // meta map
-              [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ],
-              [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) ]
-            ]
+    input = [ 
+        [ id:'test'], // meta map
+        file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true),
+        file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true)
+    ]
+    get_output_stats = false

-    UMITOOLS_DEDUP ( input )
+    UMITOOLS_DEDUP ( input, get_output_stats )
 }

 //
-// Test with single-end data
+// Test with single-end data without --output-stats
 //
-workflow test_umitools_dedup_single_end {
-    input = [ [ id:'test', single_end:true ], // meta map
-              [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ]
-            ]
-
+workflow test_umitools_dedup_single_end_no_stats {
+    input = [ 
+        [ id:'test', single_end:true ], // meta map
+        file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+    ]
    fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    get_output_stats = false

    UMITOOLS_EXTRACT ( input )
    BWA_INDEX ( fasta )
    BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true )
-    SAMTOOLS_INDEX (BWA_MEM.out.bam)
-    UMITOOLS_DEDUP(BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]))
+    SAMTOOLS_INDEX ( BWA_MEM.out.bam )
+    UMITOOLS_DEDUP ( BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]), get_output_stats )
 }

 //
-// Test with paired-end data
+// Test with paired-end data without --output-stats
 //
-workflow test_umitools_dedup_paired_end {
-    input = [ [ id:'test', single_end:false ], // meta map
-              [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
-                file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ]
-            ]
-
+workflow test_umitools_dedup_paired_end_no_stats {
+    input = [ 
+        [ id:'test', single_end:false ], // meta map
+        [ 
+            file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+            file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) 
+        ]
+    ]
    fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    get_output_stats = false

    UMITOOLS_EXTRACT ( input )
    BWA_INDEX ( fasta )
    BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true )
-    SAMTOOLS_INDEX (BWA_MEM.out.bam)
-    UMITOOLS_DEDUP(BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]))
+    SAMTOOLS_INDEX ( BWA_MEM.out.bam )
+    UMITOOLS_DEDUP ( BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]), get_output_stats )
+}
+
+//
+// Test with paired-end data with --output-stats
+//
+workflow test_umitools_dedup_paired_end_stats {
+    input = [ 
+        [ id:'test', single_end:false ], // meta map
+        [ 
+            file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+            file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) 
+        ]
+    ]
+    fasta = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    get_output_stats = true
+
+    UMITOOLS_EXTRACT ( input )
+    BWA_INDEX ( fasta )
+    BWA_MEM ( UMITOOLS_EXTRACT.out.reads, BWA_INDEX.out.index, true )
+    SAMTOOLS_INDEX ( BWA_MEM.out.bam )
+    UMITOOLS_DEDUP ( BWA_MEM.out.bam.join(SAMTOOLS_INDEX.out.bai, by: [0]), get_output_stats )
 }
--- a/tests/modules/umitools/dedup/nextflow.config
+++ b/tests/modules/umitools/dedup/nextflow.config
@ -7,11 +7,7 @@ process {
    }

    withName: UMITOOLS_DEDUP {
-        ext.args = ''
-        ext.prefix = 'dedup'
+        ext.prefix = { "${meta.id}.dedup" }
    }

-    withName: BWA_MEM {
-        ext.args2 = ''
-    }
 }
--- a/tests/modules/umitools/dedup/test.yml
+++ b/tests/modules/umitools/dedup/test.yml
@ -1,54 +1,87 @@
 - name: umitools dedup test_umitools_dedup_no_umi
-  command: nextflow run tests/modules/umitools/dedup -entry test_umitools_dedup_no_umi -c tests/config/nextflow.config
+  command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_no_umi -c ./tests/config/nextflow.config  -c ./tests/modules/umitools/dedup/nextflow.config
  tags:
    - umitools/dedup
    - umitools
  files:
-    - path: output/umitools/dedup.bam
-      md5sum: 53b4edc399db81b87d2343e78af73cf0
-    - path: output/umitools/dedup_edit_distance.tsv
-      md5sum: 65186b0964e2f8d970cc04d736d8b119
-    - path: output/umitools/dedup_per_umi.tsv
-      md5sum: 8e6783a4a79437b095f095f2aefe7c01
-    - path: output/umitools/dedup_per_umi_per_position.tsv
-      md5sum: 9386db4a104b8e4e32f3ca4a84efa4ac
-    - path: output/umitools/versions.yml
-      md5sum: 4aaaa33565bcd9a984255139933d6446
+    - path: output/umitools/test.dedup.bam

- name: umitools dedup test_umitools_dedup_single_end
-  command: nextflow run tests/modules/umitools/dedup -entry test_umitools_dedup_single_end -c tests/config/nextflow.config
+- name: umitools dedup test_umitools_dedup_single_end_no_stats
+  command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_single_end_no_stats -c ./tests/config/nextflow.config  -c ./tests/modules/umitools/dedup/nextflow.config
  tags:
-    - umitools
    - umitools/dedup
+    - umitools
  files:
+    - path: output/bwa/bwa/genome.amb
+      md5sum: 3a68b8b2287e07dd3f5f95f4344ba76e
+    - path: output/bwa/bwa/genome.ann
+      md5sum: c32e11f6c859f166c7525a9c1d583567
+    - path: output/bwa/bwa/genome.bwt
+      md5sum: 0469c30a1e239dd08f68afe66fde99da
+    - path: output/bwa/bwa/genome.pac
+      md5sum: 983e3d2cd6f36e2546e6d25a0da78d66
+    - path: output/bwa/bwa/genome.sa
+      md5sum: ab3952cabf026b48cd3eb5bccbb636d1
    - path: output/bwa/test.bam
-      md5sum: ea41a3cdca1856b22845e1067fd31f37
-    - path: output/bwa/versions.yml
-      md5sum: ce4d987f2c53f4c01b31d210c357b24a
+      md5sum: 3ecbe569cadb9b6c881917ce60779f75
    - path: output/samtools/test.bam.bai
      md5sum: 095af0ad3921212597ffd7c342ecd5a0
-    - path: output/samtools/versions.yml
-      md5sum: 69b7cde627c9b4e8403dfc125db71cc7
-    - path: output/umitools/dedup.bam
-      md5sum: d95df177063432748ff33f473910cb1e
-    - path: output/umitools/versions.yml
-      md5sum: 730e768dd199d2f5bfb6fd0850446344
+    - path: output/umitools/test.dedup.bam
+    - path: output/umitools/test.umi_extract.fastq.gz
+    - path: output/umitools/test.umi_extract.log

- name: umitools dedup test_umitools_dedup_paired_end
-  command: nextflow run tests/modules/umitools/dedup -entry test_umitools_dedup_paired_end -c tests/config/nextflow.config
+- name: umitools dedup test_umitools_dedup_paired_end_no_stats
+  command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_paired_end_no_stats -c ./tests/config/nextflow.config  -c ./tests/modules/umitools/dedup/nextflow.config
  tags:
-    - umitools
    - umitools/dedup
+    - umitools
  files:
+    - path: output/bwa/bwa/genome.amb
+      md5sum: 3a68b8b2287e07dd3f5f95f4344ba76e
+    - path: output/bwa/bwa/genome.ann
+      md5sum: c32e11f6c859f166c7525a9c1d583567
+    - path: output/bwa/bwa/genome.bwt
+      md5sum: 0469c30a1e239dd08f68afe66fde99da
+    - path: output/bwa/bwa/genome.pac
+      md5sum: 983e3d2cd6f36e2546e6d25a0da78d66
+    - path: output/bwa/bwa/genome.sa
+      md5sum: ab3952cabf026b48cd3eb5bccbb636d1
    - path: output/bwa/test.bam
-      md5sum: 1ad786cae0ff2254c655e3a206929617
-    - path: output/bwa/versions.yml
-      md5sum: b524c5ddf61c20f4a0a93ae8fc78b851
+      md5sum: e7dcbac1825bf210409b762dbb4fec8f
    - path: output/samtools/test.bam.bai
-      md5sum: 7496f4056a8e86327ca93e350f282fc2
-    - path: output/samtools/versions.yml
-      md5sum: 72fc2ab934fd4bca0f7f14a705530d34
-    - path: output/umitools/dedup.bam
-      md5sum: e8d1eae2aacef76254948c5568e94555
-    - path: output/umitools/versions.yml
-      md5sum: fd39e05042d354b3d8de49b617d3183d
+      md5sum: f75780d1de7860329b7fb4afeadc4bed
+    - path: output/umitools/test.dedup.bam
+    - path: output/umitools/test.umi_extract.log
+    - path: output/umitools/test.umi_extract_1.fastq.gz
+    - path: output/umitools/test.umi_extract_2.fastq.gz
+
+- name: umitools dedup test_umitools_dedup_paired_end_stats
+  command: nextflow run ./tests/modules/umitools/dedup -entry test_umitools_dedup_paired_end_stats -c ./tests/config/nextflow.config  -c ./tests/modules/umitools/dedup/nextflow.config
+  tags:
+    - umitools/dedup
+    - umitools
+  files:
+    - path: output/bwa/bwa/genome.amb
+      md5sum: 3a68b8b2287e07dd3f5f95f4344ba76e
+    - path: output/bwa/bwa/genome.ann
+      md5sum: c32e11f6c859f166c7525a9c1d583567
+    - path: output/bwa/bwa/genome.bwt
+      md5sum: 0469c30a1e239dd08f68afe66fde99da
+    - path: output/bwa/bwa/genome.pac
+      md5sum: 983e3d2cd6f36e2546e6d25a0da78d66
+    - path: output/bwa/bwa/genome.sa
+      md5sum: ab3952cabf026b48cd3eb5bccbb636d1
+    - path: output/bwa/test.bam
+      md5sum: e7dcbac1825bf210409b762dbb4fec8f
+    - path: output/samtools/test.bam.bai
+      md5sum: f75780d1de7860329b7fb4afeadc4bed
+    - path: output/umitools/test.dedup.bam
+    - path: output/umitools/test.dedup_edit_distance.tsv
+      md5sum: c247a49b58768e6e2e86a6c08483e612
+    - path: output/umitools/test.dedup_per_umi.tsv
+      md5sum: 10e35ca37f2bfb521ac6dd7314951a68
+    - path: output/umitools/test.dedup_per_umi_per_position.tsv
+      md5sum: 2e1a12e6f720510880068deddeefe063
+    - path: output/umitools/test.umi_extract.log
+    - path: output/umitools/test.umi_extract_1.fastq.gz
+    - path: output/umitools/test.umi_extract_2.fastq.gz
--- a/tests/modules/vsearch/usearchglobal/main.nf
+++ b/tests/modules/vsearch/usearchglobal/main.nf
@ -0,0 +1,25 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { VSEARCH_USEARCHGLOBAL } from '../../../../modules/vsearch/usearchglobal/main.nf'
+
+workflow test_vsearch_usearchglobal {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "xcfert"  // Nonsense text to check default case.
+    columns = "" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}
+
+workflow test_vsearch_usearchglobal_userout {
+    
+    query = file(params.test_data['sarscov2']['genome']['transcriptome_fasta'], checkIfExists: true)
+    db = file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+    idcutoff = 0.985
+    outoption = "userout"
+    columns = "query+target+id" 
+    VSEARCH_USEARCHGLOBAL ( [[id:'test'], query], db, idcutoff, outoption, columns )
+}
--- a/tests/modules/vsearch/usearchglobal/nextflow.config
+++ b/tests/modules/vsearch/usearchglobal/nextflow.config
@ -0,0 +1,4 @@
+process {
+    publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
+} 
+
--- a/tests/modules/vsearch/usearchglobal/test.yml
+++ b/tests/modules/vsearch/usearchglobal/test.yml
@ -0,0 +1,26 @@
+- name: vsearch usearchglobal test_vsearch_usearchglobal
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.aln
+      contains:
+        - "vsearch --usearch_global transcriptome.fasta --db genome.fasta --id 0.985 --threads 2 --alnout test.aln"
+        - "Query >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "%Id   TLen  Target"
+        - "100%  29829  MT192765.1"
+        - "Query  3822nt >lcl|MT192765.1_cds_QIK50427.1_2"
+        - "Target 29829nt >MT192765.1"
+        - "Qry 21249 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21291"
+        - "Tgt 21506 + CAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAA 21548"
+        - "21291 cols, 21290 ids (100.0%), 1 gaps (0.0%)"
+
+- name: vsearch usearchglobal test_vsearch_usearchglobal_userout
+  command: nextflow run ./tests/modules/vsearch/usearchglobal -entry test_vsearch_usearchglobal_userout -c ./tests/config/nextflow.config  -c ./tests/modules/vsearch/usearchglobal/nextflow.config
+  tags:
+    - vsearch/usearchglobal
+    - vsearch
+  files:
+    - path: output/vsearch/test.tsv
+      md5sum: b6cc50f7c8d18cb82e74dab70ed4baab