Merge pull request #237 from KevinMenden/gatk4-mergevcfs

Gatk4 mergevcfs

.github/filters.yml

@@ -128,6 +128,10 @@ gatk_createsequencedictionary:
   - software/gatk/createsequencedictionary/**
   - tests/software/gatk/createsequencedictionary/**
 
+gatk4_mergevcfs:
+  - software/gatk4/mergevcfs/**
+  - tests/software/gatk4/mergevcfs/**
+
 gatk4_bedtointervallist:
   - software/gatk4/bedtointervallist/**
   - tests/software/gatk4/bedtointervallist/**

software/gatk4/mergevcfs/functions.nf

@@ -0,0 +1,59 @@
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", "") } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/gatk4/mergevcfs/main.nf

@@ -0,0 +1,48 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+def options    = initOptions(params.options)
+
+process GATK4_MERGEVCFS {
+    tag "$meta.id"
+    label 'process_medium'
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:meta.id) }
+
+    conda (params.enable_conda ? 'bioconda::gatk4:4.1.9.0' : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container 'https://depot.galaxyproject.org/singularity/gatk4:4.1.9.0--py39_0'
+    } else {
+        container 'quay.io/biocontainers/gatk4:4.1.9.0--py39_0'
+    }
+
+    input:
+    tuple val(meta), path(vcfs)
+    path(ref_dict)
+    val use_ref_dict
+
+    output:
+    tuple val(meta), path('*.vcf.gz')       , emit: vcf
+    path  '*.version.txt'                   , emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    def prefix   = options.suffix ? "${meta.id}.${options.suffix}" : "${meta.id}"
+    // Make list of VCFs to merge
+    def input = ""
+    for (vcf in vcfs) {
+        input += " I=${vcf}"
+    }
+    def ref = use_ref_dict ? "D=${ref_dict}" : ""
+    """
+    gatk MergeVcfs \\
+        $input \\
+        O=${prefix}.merged.vcf.gz \\
+        $ref \\
+        $options.args
+
+    gatk --version | grep Picard | sed "s/Picard Version: //g" > ${software}.version.txt
+    """
+}

software/gatk4/mergevcfs/meta.yml

@@ -0,0 +1,63 @@
+name: gatk4_mergevcfs
+description: Merges several vcf files
+keywords:
+  - vcf
+  - merge
+tools:
+  - gatk4:
+      description: |
+        Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools
+        with a primary focus on variant discovery and genotyping. Its powerful processing engine
+        and high-performance computing features make it capable of taking on projects of any size.
+      homepage: https://gatk.broadinstitute.org/hc/en-us
+      documentation: https://gatk.broadinstitute.org/hc/en-us/categories/360002369672s
+      doi: 10.1158/1538-7445.AM2017-3590
+params:
+  - outdir:
+      type: string
+      description: |
+        The pipeline's output directory. By default, the module will
+        output files into `$params.outdir/<SOFTWARE>`
+  - publish_dir_mode:
+      type: string
+      description: |
+        Value for the Nextflow `publishDir` mode parameter.
+        Available: symlink, rellink, link, copy, copyNoFollow, move.
+  - enable_conda:
+      type: boolean
+      description: |
+        Run the module with Conda using the software specified
+        via the `conda` directive
+  - singularity_pull_docker_container:
+      type: boolean
+      description: |
+        Instead of directly downloading Singularity images for use with Singularity,
+        force the workflow to pull and convert Docker containers instead.
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test']
+  - bam:
+      type: list
+      description: Two or more VCF files
+      pattern: "*.{vcf,vcf.gz}"
+  - ref_dict:
+      type: file
+      description: Optional Sequence Dictionary as input
+      pattern: "*.dict"
+  - use_ref_dict:
+      type: boolean
+      description: Specify whether or not to use a given reference dictionary
+output:
+  - vcf:
+      type: file
+      description: merged vcf file
+      pattern: "*.vcf.gz"
+  - version:
+      type: file
+      description: File containing software version
+      pattern: "*.version.txt"
+authors:
+  - "@kevinmenden"

tests/data/fasta/test.consensus.for_vcf.dict

@@ -0,0 +1,3 @@
+@HD	VN:1.6
+@SQ	SN:1	LN:500	M5:98994ca39b95ec4c96496f6aa8c5c118	UR:file:/Users/kevin/Documents/nfcore/modules/tests/data/fasta/test.consensus.fa
+@SQ	SN:2	LN:501	M5:6cb9f5c857251ffe4420b42453dc9ca3	UR:file:/Users/kevin/Documents/nfcore/modules/tests/data/fasta/test.consensus.fa

tests/data/fasta/test.consensus.for_vcf.fa

@@ -0,0 +1,20 @@
+>1
+TACcAtATgTgACAtATAAaAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTG
+cAGAAAAGGAAGACTTAAAAAGAGTCAGTACTAACCTACATAATATATACAATGTTCATT
+AAATAATAAAATGAGCTCATCATACTTAGGTCATCATAAATATATCTGAAATTCACAAAT
+ATTGATCAAATGGTAAAATAGACAAGTAGATTTTAATAGGTTAAACAATTACTGATTCTC
+TTGAAAGAATAAATTTAATATGAGACCTATTTCATTATAATGAACTCACAAATTAGAAAC
+TTCACACTGGGGGCTGGAGAGATGGCTCAGTAGTTAAGAACACTGACTGCTCTTCTGAAG
+GTCCTGAGTTCAAATCCCAGCAACCACATGGTGACTTACAACCATCTGTAATGACATCTG
+ATGCCCTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATAAAATAATAAATAAATC
+TTTAAAAACAAAAAAAAAGAA
+>2
+gaagatcttttccttattaaggatctgaagctctgtagatttgtattctattaaacatgg
+AgagattagtgattttccatattctttaagtcattttagagtaatgtgttcttaagatAa
+atcagaaaaacaaaaacttgtgctttcctgtttgaaaaacaaacagctgtggggaatgGt
+gtcgggacagcctttttatAaaatttttctaaataatgttgaggctttgatacgtcaaag
+ttatatttcaaatggaatcacttagacctcgtttctgagtgtcaatggccatattggggA
+tttgctgctgccaatgacaGcacaccctgggaatgccccaactacttactacaaagcagt
+gttacatggagaagatcttcaagagtctttttgctagatctttccttggcttttgatgtg
+actcctctcaataaaatccacagtaatatagtgagtggtctcctgctccaaaccagtatt
+Tcagacacagttaatccagac

tests/software/gatk4/mergevcfs/main.nf

@@ -0,0 +1,31 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { GATK4_MERGEVCFS } from '../../../../software/gatk4/mergevcfs/main.nf' addParams( options: [:] )
+
+workflow test_gatk4_mergevcfs {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test2.vcf.gz", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test3.vcf.gz", checkIfExists: true)  ] ]
+
+    ref_dict = file("tests/data/fasta/test.consensus.for_vcf.dict", checkIfExists: true)
+
+    GATK4_MERGEVCFS ( input, ref_dict, false )
+}
+
+workflow test_gatk4_mergevcfs_refdict {
+
+    def input = []
+    input = [ [ id:'test' ], // meta map
+              [ file("${launchDir}/tests/data/vcf/test.vcf", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test2.vcf.gz", checkIfExists: true),
+                file("${launchDir}/tests/data/vcf/test3.vcf.gz", checkIfExists: true)  ] ]
+
+    ref_dict = file("tests/data/fasta/test.consensus.for_vcf.dict", checkIfExists: true)
+
+    GATK4_MERGEVCFS ( input, ref_dict, true )
+}

tests/software/gatk4/mergevcfs/test.yml

@@ -0,0 +1,17 @@
+- name: gatk4 mergevcfs
+  command: nextflow run ./tests/software/gatk4/mergevcfs -entry test_gatk4_mergevcfs -c tests/config/nextflow.config
+  tags:
+    - gatk4
+    - gatk4_mergevcfs
+  files:
+    - path: output/gatk4/test.merged.vcf.gz
+      md5sum: f25850b7bd4d362b5ea67d4453e9df55
+
+- name: gatk4 mergevcfs refdict
+  command: nextflow run ./tests/software/gatk4/mergevcfs -entry test_gatk4_mergevcfs_refdict -c tests/config/nextflow.config
+  tags:
+    - gatk4
+    - gatk4_mergevcfs
+  files:
+    - path: output/gatk4/test.merged.vcf.gz
+      md5sum: f25850b7bd4d362b5ea67d4453e9df55