"description":"Path to comma-separated file containing information about the samples and libraries/runs.",
"help_text":"You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
"description":"Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
"help_text":"You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
"description":"Email address for completion summary.",
"fa_icon":"fas fa-envelope",
"help_text":"Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
"help_text":"This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- PoreChop\n- FiltLong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
"help_text":"Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
"help_text":"Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
"help_text":"Specify a custom forward or R1 adapter sequence to be removed off of reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp parameter `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
"help_text":"Specify a custom reverse or R2 adapter sequence to be removed off of reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp parameter `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
"description":"Turn on merging of read pairs for paired-end data",
"default":true,
"help_text":"Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
"description":"Discard unmerged reads from paired-end merging",
"help_text":"Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - fastp: `--include_unmerged`\n"
"description":"Specify the minimum length of reads to be retained",
"help_text":"Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - fastp: `--length_required`\n> - AdapterRemoval: `--minlength`"
"description":"Turns on nucleotide sequence complexity filtering",
"help_text":"Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
"description":"Specify the minimum sequence entropy level for complexity filtering",
"help_text":"Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++: `-lc_entropy`\n\n"
"description":"Specify the minimum complexity filter threshold of fastp",
"help_text":"Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - fastp: `--complexity_threshold`"
"description":"Specify the minimum dust score for PRINTSEQ++ complexity filtering",
"help_text":"Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
"description":"Turns on long read quality control steps (adapter clipping, length filtering etc.)",
"help_text":"Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
"help_text":"Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
"help_text":"Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
"help_text":"Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
"description":"Specify the percent of high-quality bases to be retained",
"fa_icon":"fas fa-percentage",
"help_text":"Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
"description":"Specify the number of high-quality bases in the library to be retained",
"fa_icon":"fas fa-bullseye",
"help_text":"Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
"help_text":"Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
"help_text":"Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
"description":"Specify path to single reference FASTA of host(s) genome(s)",
"help_text":"Specify a path to the FASTA file of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
"description":"Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
"help_text":"Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference` .\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you"
"description":"Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
"help_text":"Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
"description":"Save mapping index of input reference when not already supplied by user",
"help_text":"Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned of if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
"description":"Save mapped reads in BAM format from host removal",
"help_text":"Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
"description":"Save unmapped reads in FASTQ format from host removal",
"help_text":"Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
"help_text":"Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ maybe useful, so this parameter may not always be suitable. "
"description":"Parameters used to describe centralised config profiles. These should not be edited.",
"help_text":"The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
"properties":{
"custom_config_version":{
"type":"string",
"description":"Git commit id for Institutional configs.",
"default":"master",
"hidden":true,
"fa_icon":"fas fa-users-cog"
},
"custom_config_base":{
"type":"string",
"description":"Base directory for Institutional configs.",
"help_text":"If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
"description":"Set the top limit for requested resources for any single job.",
"help_text":"If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
"properties":{
"max_cpus":{
"type":"integer",
"description":"Maximum number of CPUs that can be requested for any single job.",
"default":16,
"fa_icon":"fas fa-microchip",
"hidden":true,
"help_text":"Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
},
"max_memory":{
"type":"string",
"description":"Maximum amount of memory that can be requested for any single job.",
"default":"128.GB",
"fa_icon":"fas fa-memory",
"pattern":"^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
"hidden":true,
"help_text":"Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
},
"max_time":{
"type":"string",
"description":"Maximum amount of time that can be requested for any single job.",
"default":"240.h",
"fa_icon":"far fa-clock",
"pattern":"^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
"hidden":true,
"help_text":"Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
}
}
},
"generic_options":{
"title":"Generic options",
"type":"object",
"fa_icon":"fas fa-file-import",
"description":"Less common options for the pipeline, typically set in a config file.",
"help_text":"These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
"description":"Method used to save pipeline results to output directory.",
"help_text":"The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
"help_text":"An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
"hidden":true
},
"plaintext_email":{
"type":"boolean",
"description":"Send plain-text email instead of HTML.",
"fa_icon":"fas fa-remove-format",
"hidden":true
},
"max_multiqc_email_size":{
"type":"string",
"description":"File size limit when attaching MultiQC reports to summary emails.",
"pattern":"^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
"default":"25.MB",
"fa_icon":"fas fa-file-upload",
"hidden":true
},
"monochrome_logs":{
"type":"boolean",
"description":"Do not use coloured log outputs.",
"fa_icon":"fas fa-palette",
"hidden":true
},
"multiqc_config":{
"type":"string",
"description":"Custom config file to supply to MultiQC.",
"fa_icon":"fas fa-cog",
"hidden":true
},
"tracedir":{
"type":"string",
"description":"Directory to keep pipeline Nextflow logs and reports.",
"default":"${params.outdir}/pipeline_info",
"fa_icon":"fas fa-cogs",
"hidden":true
},
"validate_params":{
"type":"boolean",
"description":"Boolean whether to validate parameters against the schema at runtime",
"default":true,
"fa_icon":"fas fa-check-square",
"hidden":true
},
"show_hidden_params":{
"type":"boolean",
"fa_icon":"far fa-eye-slash",
"description":"Show all params when using `--help`",
"hidden":true,
"help_text":"By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
},
"enable_conda":{
"type":"boolean",
"description":"Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
"help_text":"If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
"description":"Do not load the iGenomes reference config.",
"fa_icon":"fas fa-ban",
"hidden":true,
"help_text":"Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
