Fix adapterremoval adapter conflict and add optional adapter list file

conf/modules.config

@@ -100,8 +100,7 @@ process {
     withName: ADAPTERREMOVAL_SINGLE {
         ext.args   = [
             // trimming options
-            params.shortread_qc_skipadaptertrim ? "--adapter1 '' --adapter2 ''" : "",
+            params.shortread_qc_skipadaptertrim ? "--adapter1 ''" : params.shortread_qc_adapterlist ? "" : params.shortread_qc_adapter1 ? "--adapter1 ${params.shortread_qc_adapter1}" : "",
-            params.shortread_qc_adapter1 ? "--adapter1 ${params.shortread_qc_adapter1}" : "",
             // filtering options
             "--minlength ${params.shortread_qc_minlength}"
         ].join(' ').trim()
@@ -119,9 +118,8 @@ process {
             // collapsing options
             params.shortread_qc_mergepairs ? "--collapse" : "",
             // trimming options
-            params.shortread_qc_skipadaptertrim ? "--adapter1 '' --adapter2 ''" : "",
+            params.shortread_qc_skipadaptertrim ? "--adapter1 ''" : params.shortread_qc_adapterlist ? "" : params.shortread_qc_adapter1 ? "--adapter1 ${params.shortread_qc_adapter1}" : "", // adding adapter list happens at module input channel level
-            params.shortread_qc_adapter1 ? "--adapter1 ${params.shortread_qc_adapter1}" : "",
+            params.shortread_qc_skipadaptertrim ? "--adapter2 ''" : params.shortread_qc_adapterlist ? "" : params.shortread_qc_adapter2 ? "--adapter2 ${params.shortread_qc_adapter2}" : "",
-            params.shortread_qc_adapter2 ? "--adapter2 ${params.shortread_qc_adapter2}" : "",
             // filtering options
             "--minlength ${params.shortread_qc_minlength}"
         ].join(' ').trim()

modules.json

@@ -7,7 +7,7 @@
                 "nf-core": {
                     "adapterremoval": {
                         "branch": "master",
-                        "git_sha": "5e34754d42cd2d5d248ca8673c0a53cdf5624905"
+                        "git_sha": "ce7cf27e377fdacf7ebe8e75903ec70405ea1659"
                     },
                     "bbmap/bbduk": {
                         "branch": "master",

modules/nf-core/adapterremoval/main.nf

@@ -34,7 +34,7 @@ process ADAPTERREMOVAL {
         AdapterRemoval  \\
             --file1 $reads \\
             $args \\
-            $adapterlist \\
+            $list \\
             --basename ${prefix} \\
             --threads ${task.cpus} \\
             --seed 42 \\
@@ -61,7 +61,7 @@ process ADAPTERREMOVAL {
             --file1 ${reads[0]} \\
             --file2 ${reads[1]} \\
             $args \\
-            $adapterlist \\
+            $list \\
             --basename ${prefix} \\
             --threads $task.cpus \\
             --seed 42 \\

nextflow.config

@@ -59,9 +59,9 @@ params {
     // Databases
     databases = null
 
+    // FASTQ preprocessing
     preprocessing_qc_tool            = 'fastqc'
 
-    // FASTQ preprocessing
     perform_shortread_qc             = false
     shortread_qc_tool                = 'fastp'
     shortread_qc_skipadaptertrim     = false
@@ -69,6 +69,7 @@ params {
     shortread_qc_excludeunmerged     = false
     shortread_qc_adapter1            = null
     shortread_qc_adapter2            = null
+    shortread_qc_adapterlist         = null // TODO Add for FASTP
     shortread_qc_minlength           = 15
 
     perform_longread_qc                   = false

nextflow_schema.json

@@ -10,7 +10,11 @@
             "type": "object",
             "fa_icon": "fas fa-terminal",
             "description": "Define where the pipeline should find input data and save output data.",
-            "required": ["input", "outdir", "databases"],
+            "required": [
+                "input",
+                "databases",
+                "outdir"
+            ],
             "properties": {
                 "input": {
                     "type": "string",
@@ -80,7 +84,10 @@
                 "shortread_qc_tool": {
                     "type": "string",
                     "default": "fastp",
-                    "enum": ["fastp", "adapterremoval"],
+                    "enum": [
+                        "fastp",
+                        "adapterremoval"
+                    ],
                     "fa_icon": "fas fa-tools",
                     "description": "Specify which tool to use for short-read QC"
                 },
@@ -104,6 +111,12 @@
                     "description": "Specify adapter 2 nucleotide sequence",
                     "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
                 },
+                "shortread_qc_adapterlist": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-list-ul",
+                    "help_text": "This affects AdapterRemoval. It will replace default adapters or whatever is supplied in `--shortread_qc_adapter{1,2}`.\n\nThis allows you to mix libraries built with different adapters into one run.\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--adapter-list`."
+                },
                 "shortread_qc_mergepairs": {
                     "type": "boolean",
                     "fa_icon": "fas fa-toggle-on",
@@ -133,7 +146,11 @@
                 "shortread_complexityfilter_tool": {
                     "type": "string",
                     "default": "bbduk",
-                    "enum": ["bbduk", "prinseqplusplus", "fastp"],
+                    "enum": [
+                        "bbduk",
+                        "prinseqplusplus",
+                        "fastp"
+                    ],
                     "fa_icon": "fas fa-hammer",
                     "description": "Specify which tool to use for complexity filtering"
                 },
@@ -167,7 +184,10 @@
                 "shortread_complexityfilter_prinseqplusplus_mode": {
                     "type": "string",
                     "default": "entropy",
-                    "enum": ["entropy", "dust"],
+                    "enum": [
+                        "entropy",
+                        "dust"
+                    ],
                     "fa_icon": "fas fa-check-square",
                     "description": "Specify the complexity filter mode for PRINSEQ++"
                 },
@@ -341,7 +361,15 @@
                 "diamond_output_format": {
                     "type": "string",
                     "default": "tsv",
-                    "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
+                    "enum": [
+                        "blast",
+                        "xml",
+                        "txt",
+                        "daa",
+                        "sam",
+                        "tsv",
+                        "paf"
+                    ],
                     "fa_icon": "fas fa-file",
                     "description": "Specify output format from DIAMOND profiling.",
                     "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
@@ -360,7 +388,14 @@
                 "kaiju_taxon_rank": {
                     "type": "string",
                     "default": "species",
-                    "enum": ["phylum", "class", "order", "family", "genus", "species"],
+                    "enum": [
+                        "phylum",
+                        "class",
+                        "order",
+                        "family",
+                        "genus",
+                        "species"
+                    ],
                     "fa_icon": "fas fa-tag",
                     "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
                     "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
@@ -555,7 +590,14 @@
                     "description": "Method used to save pipeline results to output directory.",
                     "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                     "fa_icon": "fas fa-copy",
-                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
+                    "enum": [
+                        "symlink",
+                        "rellink",
+                        "link",
+                        "copy",
+                        "copyNoFollow",
+                        "move"
+                    ],
                     "hidden": true
                 },
                 "email_on_fail": {
@@ -711,10 +753,7 @@
     "properties": {
         "preprocessing_qc_tool": {
             "type": "string",
-            "default": "fastqc",
+            "default": "fastqc"
-            "enum": ["fastqc", "falco"],
-            "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
-            "description": "Specify the tool used for quality control of raw sequencing reads"
         }
     }
 }

subworkflows/local/shortread_adapterremoval.nf

@@ -10,6 +10,7 @@ workflow SHORTREAD_ADAPTERREMOVAL {
 
     take:
     reads // [[meta], [reads]]
+    adapterlist // file
 
     main:
     ch_versions = Channel.empty()
@@ -21,8 +22,8 @@ workflow SHORTREAD_ADAPTERREMOVAL {
                                         paired: !it[0].single_end
                                     }
 
-    ADAPTERREMOVAL_SINGLE ( ch_input_for_adapterremoval.single, [] )
+    ADAPTERREMOVAL_SINGLE ( ch_input_for_adapterremoval.single, adapterlist )
-    ADAPTERREMOVAL_PAIRED ( ch_input_for_adapterremoval.paired, [] )
+    ADAPTERREMOVAL_PAIRED ( ch_input_for_adapterremoval.paired, adapterlist )
 
     /*
      * Due to the ~slightly~ very ugly output implementation of the current AdapterRemoval2 version, each file

subworkflows/local/shortread_preprocessing.nf

@@ -11,6 +11,7 @@ include { FALCO as FALCO_PROCESSED    } from '../../modules/nf-core/falco/main'
 workflow SHORTREAD_PREPROCESSING {
     take:
     reads //  [ [ meta ], [ reads ] ]
+    adapterlist // file
 
     main:
     ch_versions       = Channel.empty()

workflows/taxprofiler.nf

@@ -12,7 +12,8 @@ WorkflowTaxprofiler.initialise(params, log)
 // TODO nf-core: Add all file path parameters for the pipeline to the list below
 // Check input path parameters to see if they exist
 def checkPathParamList = [ params.input, params.databases, params.hostremoval_reference,
-                            params.shortread_hostremoval_index, params.multiqc_config
+                            params.shortread_hostremoval_index, params.multiqc_config,
+                            params.shortread_qc_adapterlist
                         ]
 for (param in checkPathParamList) { if (param) { file(param, checkIfExists: true) } }
 
@@ -102,6 +103,7 @@ workflow TAXPROFILER {
 
     ch_versions = Channel.empty()
     ch_multiqc_logo= Channel.fromPath("$projectDir/docs/images/nf-core-taxprofiler_logo_custom_light.png")
+    ch_adapterlist_for_shortreadqc = params.shortread_qc_adapterlist ? file(params.shortread_qc_adapterlist) : []
 
     /*
         SUBWORKFLOW: Read in samplesheet, validate and stage input files
@@ -131,8 +133,11 @@ workflow TAXPROFILER {
     /*
         SUBWORKFLOW: PERFORM PREPROCESSING
     */
+
+    ch_adapterlist_for_shortreadqc
+
     if ( params.perform_shortread_qc ) {
-        ch_shortreads_preprocessed = SHORTREAD_PREPROCESSING ( INPUT_CHECK.out.fastq ).reads
+        ch_shortreads_preprocessed = SHORTREAD_PREPROCESSING ( INPUT_CHECK.out.fastq, ch_adapterlist_for_shortreadqc ).reads
         ch_versions = ch_versions.mix( SHORTREAD_PREPROCESSING.out.versions )
     } else {
         ch_shortreads_preprocessed = INPUT_CHECK.out.fastq