From 9feb6c2db6f4d6e16d4a75ceb0e4f901fd5e5f20 Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Thu, 24 Nov 2022 14:44:04 +0100
Subject: [PATCH 01/25] Update MALT

---
 conf/modules.config              | 2 +-
 modules.json                     | 2 +-
 modules/nf-core/malt/run/main.nf | 8 +++-----
 subworkflows/local/profiling.nf  | 2 +-
 4 files changed, 6 insertions(+), 8 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index f9d51d8..ea569b6 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -281,7 +281,7 @@ process {
     }
 
     withName: MALT_RUN {
-        ext.args = { "${meta.db_params}" }
+        ext.args = { "${meta.db_params} -m ${params.malt_mode}" }
         // one run with multiple samples, so fix ID to just db name to ensure clean log name
         ext.prefix = { "${meta.db_name}" }
         publishDir = [
diff --git a/modules.json b/modules.json
index 62f6539..fabd8db 100644
--- a/modules.json
+++ b/modules.json
@@ -107,7 +107,7 @@
                     },
                     "malt/run": {
                         "branch": "master",
-                        "git_sha": "5e34754d42cd2d5d248ca8673c0a53cdf5624905"
+                        "git_sha": "6d9712f03ec2de8264a50ee4541a617e1e063b51"
                     },
                     "megan/rma2info": {
                         "branch": "master",
diff --git a/modules/nf-core/malt/run/main.nf b/modules/nf-core/malt/run/main.nf
index 2b91d90..2e75b4c 100644
--- a/modules/nf-core/malt/run/main.nf
+++ b/modules/nf-core/malt/run/main.nf
@@ -2,14 +2,13 @@ process MALT_RUN {
     tag "$meta.id"
     label 'process_high'
 
-    conda (params.enable_conda ? "bioconda::malt=0.41" : null)
+    conda (params.enable_conda ? "bioconda::malt=0.61" : null)
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/malt:0.41--1' :
-        'quay.io/biocontainers/malt:0.41--1' }"
+        'https://depot.galaxyproject.org/singularity/malt:0.61--hdfd78af_0' :
+        'quay.io/biocontainers/malt:0.61--hdfd78af_0' }"
 
     input:
     tuple val(meta), path(fastqs)
-    val mode
     path index
 
     output:
@@ -38,7 +37,6 @@ process MALT_RUN {
         -o . \\
         $args \\
         --inFile ${fastqs.join(' ')} \\
-        -m $mode \\
         --index $index/ |&tee ${prefix}-malt-run.log
 
     cat <<-END_VERSIONS > versions.yml
diff --git a/subworkflows/local/profiling.nf b/subworkflows/local/profiling.nf
index b86c165..6cac3e1 100644
--- a/subworkflows/local/profiling.nf
+++ b/subworkflows/local/profiling.nf
@@ -95,7 +95,7 @@ workflow PROFILING {
                                         db: it[2]
                                 }
 
-        MALT_RUN ( ch_input_for_malt.reads, params.malt_mode, ch_input_for_malt.db )
+        MALT_RUN ( ch_input_for_malt.reads, ch_input_for_malt.db )
 
         ch_maltrun_for_megan = MALT_RUN.out.rma6
                                 .transpose()

From 131b39aa8b3ecfae3d18f781f7440929243ab3a6 Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Thu, 24 Nov 2022 15:49:06 +0100
Subject: [PATCH 02/25] Fix linting

---
 modules/nf-core/malt/run/meta.yml | 4 ----
 1 file changed, 4 deletions(-)

diff --git a/modules/nf-core/malt/run/meta.yml b/modules/nf-core/malt/run/meta.yml
index 66f2d7a..8fa1958 100644
--- a/modules/nf-core/malt/run/meta.yml
+++ b/modules/nf-core/malt/run/meta.yml
@@ -28,10 +28,6 @@ input:
       type: file
       description: Input FASTQ files
       pattern: "*.{fastq.gz,fq.gz}"
-  - mode:
-      type: string
-      description: Program mode
-      pattern: "Unknown|BlastN|BlastP|BlastX|Classifier"
   - index:
       type: directory
       description: Index/database directory from malt-build

From a20b3e3c58a54274f908afdb231739f51eb3da4e Mon Sep 17 00:00:00 2001
From: James Fellows Yates <jfy133@gmail.com>
Date: Thu, 24 Nov 2022 15:51:12 +0100
Subject: [PATCH 03/25] Try to reduce MALT memory

---
 conf/test.config                 |  1 +
 conf/test_nopreprocessing.config |  1 +
 conf/test_nothing.config         |  1 +
 conf/test_pep.config             |  1 +
 lib/WorkflowMain.groovy          | 15 ++++++++-------
 5 files changed, 12 insertions(+), 7 deletions(-)

diff --git a/conf/test.config b/conf/test.config
index 777d9bf..03b8307 100644
--- a/conf/test.config
+++ b/conf/test.config
@@ -51,6 +51,7 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
+        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
     }
     withName: MEGAN_RMA2INFO_TSV {
         maxForks = 1
diff --git a/conf/test_nopreprocessing.config b/conf/test_nopreprocessing.config
index 357f76f..c87cf6c 100644
--- a/conf/test_nopreprocessing.config
+++ b/conf/test_nopreprocessing.config
@@ -45,5 +45,6 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
+        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
     }
 }
diff --git a/conf/test_nothing.config b/conf/test_nothing.config
index df09613..0a969a6 100644
--- a/conf/test_nothing.config
+++ b/conf/test_nothing.config
@@ -44,5 +44,6 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
+        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
     }
 }
diff --git a/conf/test_pep.config b/conf/test_pep.config
index 762ebb3..3cd6dd0 100644
--- a/conf/test_pep.config
+++ b/conf/test_pep.config
@@ -37,6 +37,7 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
+        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
     }
     withName: MEGAN_RMA2INFO {
         maxForks = 1
diff --git a/lib/WorkflowMain.groovy b/lib/WorkflowMain.groovy
index 7883d70..02d4347 100755
--- a/lib/WorkflowMain.groovy
+++ b/lib/WorkflowMain.groovy
@@ -12,9 +12,9 @@ class WorkflowMain {
             // TODO nf-core: Add Zenodo DOI for pipeline after first release
             //"* The pipeline\n" +
             //"  https://doi.org/10.5281/zenodo.XXXXXXX\n\n" +
-            "* The nf-core framework\n" +
-            "  https://doi.org/10.1038/s41587-020-0439-x\n\n" +
-            "* Software dependencies\n" +
+            '* The nf-core framework\n' +
+            '  https://doi.org/10.1038/s41587-020-0439-x\n\n' +
+            '* Software dependencies\n' +
             "  https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md"
     }
 
@@ -53,15 +53,15 @@ class WorkflowMain {
             System.exit(0)
         }
 
+        // Print parameter summary log to screen
+
+        log.info paramsSummaryLog(workflow, params, log)
+
         // Validate workflow parameters via the JSON schema
         if (params.validate_params) {
             NfcoreSchema.validateParameters(workflow, params, log)
         }
 
-        // Print parameter summary log to screen
-
-        log.info paramsSummaryLog(workflow, params, log)
-
         // Check that a -profile or Nextflow config has been provided to run the pipeline
         NfcoreTemplate.checkConfigProvided(workflow, log)
 
@@ -90,4 +90,5 @@ class WorkflowMain {
         }
         return null
     }
+
 }

From 17b1e3df1c230f1767deb7cb7f3e1bdf5db09556 Mon Sep 17 00:00:00 2001
From: "James A. Fellows Yates" <jfy133@gmail.com>
Date: Thu, 24 Nov 2022 16:53:39 +0100
Subject: [PATCH 04/25] Update test.config

---
 conf/test.config | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/conf/test.config b/conf/test.config
index 03b8307..b3ad7bd 100644
--- a/conf/test.config
+++ b/conf/test.config
@@ -51,7 +51,7 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
-        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
+        ext.args = "-m ${params.malt_mode} -J-Xmx12G"
     }
     withName: MEGAN_RMA2INFO_TSV {
         maxForks = 1

From f114cc41220c9e48bc3a2f6f6c2e72e5ecade8a8 Mon Sep 17 00:00:00 2001
From: "James A. Fellows Yates" <jfy133@gmail.com>
Date: Thu, 24 Nov 2022 16:55:19 +0100
Subject: [PATCH 05/25] Apply suggestions from code review

---
 conf/test.config                 | 2 +-
 conf/test_nopreprocessing.config | 2 +-
 conf/test_nothing.config         | 2 +-
 conf/test_pep.config             | 2 +-
 4 files changed, 4 insertions(+), 4 deletions(-)

diff --git a/conf/test.config b/conf/test.config
index b3ad7bd..e79bef4 100644
--- a/conf/test.config
+++ b/conf/test.config
@@ -51,7 +51,7 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
-        ext.args = "-m ${params.malt_mode} -J-Xmx12G"
+        ext.args = { "-m ${params.malt_mode} -J-Xmx12G" }
     }
     withName: MEGAN_RMA2INFO_TSV {
         maxForks = 1
diff --git a/conf/test_nopreprocessing.config b/conf/test_nopreprocessing.config
index c87cf6c..eae6144 100644
--- a/conf/test_nopreprocessing.config
+++ b/conf/test_nopreprocessing.config
@@ -45,6 +45,6 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
-        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
+        ext.args = { "-m ${params.malt_mode} -J-Xmx12G" }
     }
 }
diff --git a/conf/test_nothing.config b/conf/test_nothing.config
index 0a969a6..ca75380 100644
--- a/conf/test_nothing.config
+++ b/conf/test_nothing.config
@@ -44,6 +44,6 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
-        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
+        ext.args = { "-m ${params.malt_mode} -J-Xmx12G" }
     }
 }
diff --git a/conf/test_pep.config b/conf/test_pep.config
index 3cd6dd0..6ce788d 100644
--- a/conf/test_pep.config
+++ b/conf/test_pep.config
@@ -37,7 +37,7 @@ params {
 process {
     withName: MALT_RUN {
         maxForks = 1
-        ext.args = "-m ${params.malt_mode} -J-Xmx8G"
+        ext.args = { "-m ${params.malt_mode} -J-Xmx12G" }
     }
     withName: MEGAN_RMA2INFO {
         maxForks = 1

From 49af33f68ea7ab216db898adc24fe2489a8c2f03 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 11:07:29 +0100
Subject: [PATCH 06/25] Include NCBI_id, read counts and mgc arguments in motus

---
 conf/modules.config    | 1 +
 conf/test_motus.config | 3 +++
 nextflow.config        | 3 +++
 3 files changed, 7 insertions(+)

diff --git a/conf/modules.config b/conf/modules.config
index f9d51d8..5c35525 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -446,6 +446,7 @@ process {
     }
 
     withName: MOTUS_PROFILE {
+        ext.args = { [ params.save_ncbi_id ? "-p" : "", params.save_read_counts ? "-c" : "", params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : "" ].join(',').replaceAll(','," ") }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
         publishDir = [
             path: { "${params.outdir}/motus/${meta.db_name}/" },
diff --git a/conf/test_motus.config b/conf/test_motus.config
index d167b94..70681dd 100644
--- a/conf/test_motus.config
+++ b/conf/test_motus.config
@@ -39,5 +39,8 @@ params {
     run_centrifuge                        = false
     run_diamond                           = false
     run_motus                             = true
+    save_mgc_counts                       = true
+    save_ncbi_id                          = true
+    save_read_counts                      = true
     run_profile_standardisation           = true
 }
diff --git a/nextflow.config b/nextflow.config
index c59d433..91875b2 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -140,6 +140,9 @@ params {
 
     // mOTUs
     run_motus                  = false
+    save_mgc_counts            = false
+    save_ncbi_id               = false
+    save_read_counts           = false
 
     // krona
     run_krona                  = false

From 0235ef42ca0bf062648bd1b1f7bc18827c545a65 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 11:15:40 +0100
Subject: [PATCH 07/25] Update nextflow_schema.json

---
 nextflow_schema.json | 69 ++++++++++++++++++++++++++++++++++++++------
 1 file changed, 60 insertions(+), 9 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index a66b0f1..5df56d8 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -10,7 +10,11 @@
             "type": "object",
             "fa_icon": "fas fa-terminal",
             "description": "Define where the pipeline should find input data and save output data.",
-            "required": ["input", "databases", "outdir"],
+            "required": [
+                "input",
+                "databases",
+                "outdir"
+            ],
             "properties": {
                 "input": {
                     "type": "string",
@@ -80,7 +84,10 @@
                 "shortread_qc_tool": {
                     "type": "string",
                     "default": "fastp",
-                    "enum": ["fastp", "adapterremoval"],
+                    "enum": [
+                        "fastp",
+                        "adapterremoval"
+                    ],
                     "fa_icon": "fas fa-tools",
                     "description": "Specify which tool to use for short-read QC"
                 },
@@ -139,7 +146,11 @@
                 "shortread_complexityfilter_tool": {
                     "type": "string",
                     "default": "bbduk",
-                    "enum": ["bbduk", "prinseqplusplus", "fastp"],
+                    "enum": [
+                        "bbduk",
+                        "prinseqplusplus",
+                        "fastp"
+                    ],
                     "fa_icon": "fas fa-hammer",
                     "description": "Specify which tool to use for complexity filtering"
                 },
@@ -173,7 +184,10 @@
                 "shortread_complexityfilter_prinseqplusplus_mode": {
                     "type": "string",
                     "default": "entropy",
-                    "enum": ["entropy", "dust"],
+                    "enum": [
+                        "entropy",
+                        "dust"
+                    ],
                     "fa_icon": "fas fa-check-square",
                     "description": "Specify the complexity filter mode for PRINSEQ++"
                 },
@@ -347,7 +361,15 @@
                 "diamond_output_format": {
                     "type": "string",
                     "default": "tsv",
-                    "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
+                    "enum": [
+                        "blast",
+                        "xml",
+                        "txt",
+                        "daa",
+                        "sam",
+                        "tsv",
+                        "paf"
+                    ],
                     "fa_icon": "fas fa-file",
                     "description": "Specify output format from DIAMOND profiling.",
                     "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
@@ -366,7 +388,14 @@
                 "kaiju_taxon_rank": {
                     "type": "string",
                     "default": "species",
-                    "enum": ["phylum", "class", "order", "family", "genus", "species"],
+                    "enum": [
+                        "phylum",
+                        "class",
+                        "order",
+                        "family",
+                        "genus",
+                        "species"
+                    ],
                     "fa_icon": "fas fa-tag",
                     "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
                     "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
@@ -572,7 +601,14 @@
                     "description": "Method used to save pipeline results to output directory.",
                     "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                     "fa_icon": "fas fa-copy",
-                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
+                    "enum": [
+                        "symlink",
+                        "rellink",
+                        "link",
+                        "copy",
+                        "copyNoFollow",
+                        "move"
+                    ],
                     "hidden": true
                 },
                 "email_on_fail": {
@@ -729,9 +765,24 @@
         "preprocessing_qc_tool": {
             "type": "string",
             "default": "fastqc",
-            "enum": ["fastqc", "falco"],
+            "enum": [
+                "fastqc",
+                "falco"
+            ],
             "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
             "description": "Specify the tool used for quality control of raw sequencing reads"
+        },
+        "save_mgc_counts": {
+            "type": "string",
+            "description": "Save the mgc reads count in mOTUs."
+        },
+        "save_ncbi_id": {
+            "type": "string",
+            "description": "Print NCBI id in mOTUs."
+        },
+        "save_read_counts": {
+            "type": "string",
+            "description": "Print result as counts instead of relative abundances in mOTUs."
         }
     }
-}
+}
\ No newline at end of file

From 5254b8d679b64b903984c2d6e21fea9580efacca Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 11:25:52 +0100
Subject: [PATCH 08/25] Prettier

---
 nextflow_schema.json | 1518 +++++++++++++++++++++---------------------
 1 file changed, 743 insertions(+), 775 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index 5df56d8..58cab0c 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -1,788 +1,756 @@
 {
-    "$schema": "http://json-schema.org/draft-07/schema",
-    "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
-    "title": "nf-core/taxprofiler pipeline parameters",
-    "description": "Taxonomic profiling of shotgun metagenomic data",
-    "type": "object",
-    "definitions": {
-        "input_output_options": {
-            "title": "Input/output options",
-            "type": "object",
-            "fa_icon": "fas fa-terminal",
-            "description": "Define where the pipeline should find input data and save output data.",
-            "required": [
-                "input",
-                "databases",
-                "outdir"
-            ],
-            "properties": {
-                "input": {
-                    "type": "string",
-                    "format": "file-path",
-                    "mimetype": "text/csv",
-                    "pattern": "^\\S+\\.(csv|yaml|yml)$",
-                    "schema": "assets/schema_input.json",
-                    "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
-                    "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
-                    "fa_icon": "fas fa-file-csv"
-                },
-                "databases": {
-                    "type": "string",
-                    "mimetype": "text/csv",
-                    "format": "file-path",
-                    "fa_icon": "fas fa-database",
-                    "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
-                    "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
-                },
-                "outdir": {
-                    "type": "string",
-                    "format": "directory-path",
-                    "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
-                    "fa_icon": "fas fa-folder-open"
-                },
-                "email": {
-                    "type": "string",
-                    "description": "Email address for completion summary.",
-                    "fa_icon": "fas fa-envelope",
-                    "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
-                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
-                },
-                "multiqc_title": {
-                    "type": "string",
-                    "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
-                    "fa_icon": "fas fa-file-signature"
-                }
-            }
+  "$schema": "http://json-schema.org/draft-07/schema",
+  "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
+  "title": "nf-core/taxprofiler pipeline parameters",
+  "description": "Taxonomic profiling of shotgun metagenomic data",
+  "type": "object",
+  "definitions": {
+    "input_output_options": {
+      "title": "Input/output options",
+      "type": "object",
+      "fa_icon": "fas fa-terminal",
+      "description": "Define where the pipeline should find input data and save output data.",
+      "required": ["input", "databases", "outdir"],
+      "properties": {
+        "input": {
+          "type": "string",
+          "format": "file-path",
+          "mimetype": "text/csv",
+          "pattern": "^\\S+\\.(csv|yaml|yml)$",
+          "schema": "assets/schema_input.json",
+          "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
+          "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
+          "fa_icon": "fas fa-file-csv"
         },
-        "preprocessing_general_qc_options": {
-            "title": "Preprocessing general QC options",
-            "type": "object",
-            "description": "Common options across both long and short read preprocessing QC steps",
-            "default": "",
-            "properties": {
-                "save_preprocessed_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
-                    "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
-                }
-            },
-            "fa_icon": "fas fa-users-cog"
+        "databases": {
+          "type": "string",
+          "mimetype": "text/csv",
+          "format": "file-path",
+          "fa_icon": "fas fa-database",
+          "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
+          "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
         },
-        "preprocessing_short_read_qc_options": {
-            "title": "Preprocessing short-read QC options",
-            "type": "object",
-            "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
-            "default": "",
-            "properties": {
-                "perform_shortread_qc": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
-                    "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
-                },
-                "shortread_qc_tool": {
-                    "type": "string",
-                    "default": "fastp",
-                    "enum": [
-                        "fastp",
-                        "adapterremoval"
-                    ],
-                    "fa_icon": "fas fa-tools",
-                    "description": "Specify which tool to use for short-read QC"
-                },
-                "shortread_qc_skipadaptertrim": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-forward",
-                    "description": "Skip adapter trimming",
-                    "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
-                },
-                "shortread_qc_adapter1": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-grip-lines",
-                    "description": "Specify adapter 1 nucleotide sequence",
-                    "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
-                },
-                "shortread_qc_adapter2": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-grip-lines",
-                    "description": "Specify adapter 2 nucleotide sequence",
-                    "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
-                },
-                "shortread_qc_adapterlist": {
-                    "type": "string",
-                    "default": "None",
-                    "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
-                    "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
-                },
-                "shortread_qc_mergepairs": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on merging of read pairs for paired-end data",
-                    "default": true,
-                    "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
-                },
-                "shortread_qc_excludeunmerged": {
-                    "type": "boolean",
-                    "fa_icon": "far fa-times-circle",
-                    "description": "Discard unmerged reads from paired-end merging",
-                    "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
-                },
-                "shortread_qc_minlength": {
-                    "type": "integer",
-                    "default": 15,
-                    "fa_icon": "fas fa-ruler-horizontal",
-                    "description": "Specify the minimum length of reads to be retained",
-                    "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
-                },
-                "perform_shortread_complexityfilter": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turns on nucleotide sequence complexity filtering",
-                    "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
-                },
-                "shortread_complexityfilter_tool": {
-                    "type": "string",
-                    "default": "bbduk",
-                    "enum": [
-                        "bbduk",
-                        "prinseqplusplus",
-                        "fastp"
-                    ],
-                    "fa_icon": "fas fa-hammer",
-                    "description": "Specify which tool to use for complexity filtering"
-                },
-                "shortread_complexityfilter_entropy": {
-                    "type": "number",
-                    "default": 0.3,
-                    "fa_icon": "fas fa-random",
-                    "description": "Specify the minimum sequence entropy level for complexity filtering",
-                    "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
-                },
-                "shortread_complexityfilter_bbduk_windowsize": {
-                    "type": "integer",
-                    "default": 50,
-                    "fa_icon": "far fa-window-maximize",
-                    "description": "Specify the window size for BBDuk complexity filtering",
-                    "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
-                },
-                "shortread_complexityfilter_bbduk_mask": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-mask",
-                    "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
-                    "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
-                },
-                "shortread_complexityfilter_fastp_threshold": {
-                    "type": "integer",
-                    "default": 30,
-                    "fa_icon": "fas fa-sort-numeric-down",
-                    "description": "Specify the minimum complexity filter threshold of fastp",
-                    "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
-                },
-                "shortread_complexityfilter_prinseqplusplus_mode": {
-                    "type": "string",
-                    "default": "entropy",
-                    "enum": [
-                        "entropy",
-                        "dust"
-                    ],
-                    "fa_icon": "fas fa-check-square",
-                    "description": "Specify the complexity filter mode for PRINSEQ++"
-                },
-                "shortread_complexityfilter_prinseqplusplus_dustscore": {
-                    "type": "number",
-                    "default": 0.5,
-                    "fa_icon": "fas fa-head-side-mask",
-                    "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
-                    "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
-                },
-                "save_complexityfiltered_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save complexity filtered short-reads",
-                    "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
-                }
-            },
-            "fa_icon": "fas fa-compress-alt"
+        "outdir": {
+          "type": "string",
+          "format": "directory-path",
+          "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
+          "fa_icon": "fas fa-folder-open"
         },
-        "preprocessing_long_read_qc_options": {
-            "title": "Preprocessing long-read QC options",
-            "type": "object",
-            "description": "Options for adapter clipping, quality trimming, and length filtering",
-            "default": "",
-            "properties": {
-                "perform_longread_qc": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
-                    "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
-                },
-                "longread_qc_skipadaptertrim": {
-                    "type": "boolean",
-                    "description": "Skip long-read trimming",
-                    "fa_icon": "fas fa-forward",
-                    "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
-                },
-                "longread_qc_skipqualityfilter": {
-                    "type": "boolean",
-                    "description": "Skip long-read length and quality filtering",
-                    "fa_icon": "fas fa-forward",
-                    "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
-                },
-                "longread_qc_qualityfilter_minlength": {
-                    "type": "integer",
-                    "default": 1000,
-                    "description": "Specify the minimum length of reads to be retained",
-                    "fa_icon": "fas fa-ruler-horizontal",
-                    "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
-                },
-                "longread_qc_qualityfilter_keeppercent": {
-                    "type": "integer",
-                    "default": 90,
-                    "description": "Specify the percent of high-quality bases to be retained",
-                    "fa_icon": "fas fa-percentage",
-                    "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-                },
-                "longread_qc_qualityfilter_targetbases": {
-                    "type": "integer",
-                    "default": 500000000,
-                    "description": "Specify the number of high-quality bases in the library to be retained",
-                    "fa_icon": "fas fa-bullseye",
-                    "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-                }
-            },
-            "fa_icon": "fas fa-expand-alt"
+        "email": {
+          "type": "string",
+          "description": "Email address for completion summary.",
+          "fa_icon": "fas fa-envelope",
+          "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
+          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
         },
-        "preprocessing_host_removal_options": {
-            "title": "Preprocessing host removal options",
-            "type": "object",
-            "description": "Options for pre-profiling host read removal",
-            "default": "",
-            "properties": {
-                "perform_shortread_hostremoval": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on short-read host removal",
-                    "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-                },
-                "perform_longread_hostremoval": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on long-read host removal",
-                    "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-                },
-                "hostremoval_reference": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-file-alt",
-                    "description": "Specify path to single reference FASTA of host(s) genome(s)",
-                    "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
-                },
-                "shortread_hostremoval_index": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-address-book",
-                    "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
-                    "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-                },
-                "longread_hostremoval_index": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-address-book",
-                    "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
-                    "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-                },
-                "save_hostremoval_index": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save mapping index of input reference when not already supplied by user",
-                    "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
-                },
-                "save_hostremoval_mapped": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save mapped reads in BAM format from host removal",
-                    "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
-                },
-                "save_hostremoval_unmapped": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save unmapped reads in FASTQ format from host removal",
-                    "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
-                }
-            },
-            "fa_icon": "fas fa-user-times"
-        },
-        "preprocessing_run_merging_options": {
-            "title": "Preprocessing run merging options",
-            "type": "object",
-            "description": "Options for per-sample run-merging",
-            "default": "",
-            "properties": {
-                "perform_runmerging": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on run merging",
-                    "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
-                },
-                "save_runmerged_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save run-concatenated input FASTQ files for each sample",
-                    "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
-                }
-            },
-            "fa_icon": "fas fa-clipboard-check"
-        },
-        "profiling_options": {
-            "title": "Profiling options",
-            "type": "object",
-            "description": "",
-            "default": "",
-            "properties": {
-                "run_centrifuge": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
-                },
-                "centrifuge_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of Centrifuge-aligned reads",
-                    "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
-                },
-                "run_diamond": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
-                },
-                "diamond_output_format": {
-                    "type": "string",
-                    "default": "tsv",
-                    "enum": [
-                        "blast",
-                        "xml",
-                        "txt",
-                        "daa",
-                        "sam",
-                        "tsv",
-                        "paf"
-                    ],
-                    "fa_icon": "fas fa-file",
-                    "description": "Specify output format from DIAMOND profiling.",
-                    "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
-                },
-                "diamond_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
-                    "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
-                },
-                "run_kaiju": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
-                },
-                "kaiju_taxon_rank": {
-                    "type": "string",
-                    "default": "species",
-                    "enum": [
-                        "phylum",
-                        "class",
-                        "order",
-                        "family",
-                        "genus",
-                        "species"
-                    ],
-                    "fa_icon": "fas fa-tag",
-                    "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
-                    "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
-                },
-                "run_kraken2": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
-                },
-                "kraken2_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of Kraken2-aligned reads",
-                    "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
-                },
-                "kraken2_save_readclassification": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
-                    "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
-                },
-                "kraken2_save_minimizers": {
-                    "type": "boolean",
-                    "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
-                    "fa_icon": "fas fa-save",
-                    "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
-                },
-                "run_bracken": {
-                    "type": "boolean",
-                    "description": "Post-process kraken2 reports with Bracken.",
-                    "fa_icon": "fas fa-toggle-on"
-                },
-                "run_malt": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
-                },
-                "malt_mode": {
-                    "type": "string",
-                    "default": "BlastN",
-                    "fa_icon": "fas fa-check-square",
-                    "description": "Specify which MALT alignment mode to use",
-                    "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
-                },
-                "malt_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of MALT-aligned reads",
-                    "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
-                },
-                "malt_generate_megansummary": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on generation of MEGAN summary file from MALT results",
-                    "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
-                },
-                "run_metaphlan3": {
-                    "type": "boolean",
-                    "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
-                    "fa_icon": "fas fa-toggle-on"
-                },
-                "run_motus": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
-                }
-            },
-            "fa_icon": "fas fa-align-center"
-        },
-        "postprocessing_and_visualisation_options": {
-            "title": "Postprocessing and visualisation options",
-            "type": "object",
-            "description": "",
-            "default": "",
-            "properties": {
-                "run_profile_standardisation": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on standardisation of taxon tables across profilers",
-                    "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
-                },
-                "generate_biom_output": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
-                    "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
-                },
-                "run_krona": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on generation of Krona plots for supported profilers",
-                    "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
-                },
-                "krona_taxonomy_directory": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-folder-open",
-                    "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
-                    "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
-                }
-            },
-            "fa_icon": "fas fa-chart-line"
-        },
-        "institutional_config_options": {
-            "title": "Institutional config options",
-            "type": "object",
-            "fa_icon": "fas fa-university",
-            "description": "Parameters used to describe centralised config profiles. These should not be edited.",
-            "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
-            "properties": {
-                "custom_config_version": {
-                    "type": "string",
-                    "description": "Git commit id for Institutional configs.",
-                    "default": "master",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "custom_config_base": {
-                    "type": "string",
-                    "description": "Base directory for Institutional configs.",
-                    "default": "https://raw.githubusercontent.com/nf-core/configs/master",
-                    "hidden": true,
-                    "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_name": {
-                    "type": "string",
-                    "description": "Institutional config name.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_description": {
-                    "type": "string",
-                    "description": "Institutional config description.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_contact": {
-                    "type": "string",
-                    "description": "Institutional config contact information.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_url": {
-                    "type": "string",
-                    "description": "Institutional config URL link.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                }
-            }
-        },
-        "max_job_request_options": {
-            "title": "Max job request options",
-            "type": "object",
-            "fa_icon": "fab fa-acquisitions-incorporated",
-            "description": "Set the top limit for requested resources for any single job.",
-            "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
-            "properties": {
-                "max_cpus": {
-                    "type": "integer",
-                    "description": "Maximum number of CPUs that can be requested for any single job.",
-                    "default": 16,
-                    "fa_icon": "fas fa-microchip",
-                    "hidden": true,
-                    "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
-                },
-                "max_memory": {
-                    "type": "string",
-                    "description": "Maximum amount of memory that can be requested for any single job.",
-                    "default": "128.GB",
-                    "fa_icon": "fas fa-memory",
-                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-                    "hidden": true,
-                    "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
-                },
-                "max_time": {
-                    "type": "string",
-                    "description": "Maximum amount of time that can be requested for any single job.",
-                    "default": "240.h",
-                    "fa_icon": "far fa-clock",
-                    "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
-                    "hidden": true,
-                    "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
-                }
-            }
-        },
-        "generic_options": {
-            "title": "Generic options",
-            "type": "object",
-            "fa_icon": "fas fa-file-import",
-            "description": "Less common options for the pipeline, typically set in a config file.",
-            "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
-            "properties": {
-                "help": {
-                    "type": "boolean",
-                    "description": "Display help text.",
-                    "fa_icon": "fas fa-question-circle",
-                    "hidden": true
-                },
-                "publish_dir_mode": {
-                    "type": "string",
-                    "default": "copy",
-                    "description": "Method used to save pipeline results to output directory.",
-                    "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
-                    "fa_icon": "fas fa-copy",
-                    "enum": [
-                        "symlink",
-                        "rellink",
-                        "link",
-                        "copy",
-                        "copyNoFollow",
-                        "move"
-                    ],
-                    "hidden": true
-                },
-                "email_on_fail": {
-                    "type": "string",
-                    "description": "Email address for completion summary, only when pipeline fails.",
-                    "fa_icon": "fas fa-exclamation-triangle",
-                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
-                    "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
-                    "hidden": true
-                },
-                "plaintext_email": {
-                    "type": "boolean",
-                    "description": "Send plain-text email instead of HTML.",
-                    "fa_icon": "fas fa-remove-format",
-                    "hidden": true
-                },
-                "max_multiqc_email_size": {
-                    "type": "string",
-                    "description": "File size limit when attaching MultiQC reports to summary emails.",
-                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-                    "default": "25.MB",
-                    "fa_icon": "fas fa-file-upload",
-                    "hidden": true
-                },
-                "monochrome_logs": {
-                    "type": "boolean",
-                    "description": "Do not use coloured log outputs.",
-                    "fa_icon": "fas fa-palette",
-                    "hidden": true
-                },
-                "hook_url": {
-                    "type": "string",
-                    "description": "Incoming hook URL for messaging service",
-                    "fa_icon": "fas fa-people-group",
-                    "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
-                    "hidden": true
-                },
-                "multiqc_config": {
-                    "type": "string",
-                    "description": "Custom config file to supply to MultiQC.",
-                    "fa_icon": "fas fa-cog",
-                    "hidden": true
-                },
-                "multiqc_logo": {
-                    "type": "string",
-                    "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
-                    "fa_icon": "fas fa-image",
-                    "hidden": true
-                },
-                "multiqc_methods_description": {
-                    "type": "string",
-                    "description": "Custom MultiQC yaml file containing HTML including a methods description.",
-                    "fa_icon": "fas fa-cog"
-                },
-                "tracedir": {
-                    "type": "string",
-                    "description": "Directory to keep pipeline Nextflow logs and reports.",
-                    "default": "${params.outdir}/pipeline_info",
-                    "fa_icon": "fas fa-cogs",
-                    "hidden": true
-                },
-                "validate_params": {
-                    "type": "boolean",
-                    "description": "Boolean whether to validate parameters against the schema at runtime",
-                    "default": true,
-                    "fa_icon": "fas fa-check-square",
-                    "hidden": true
-                },
-                "show_hidden_params": {
-                    "type": "boolean",
-                    "fa_icon": "far fa-eye-slash",
-                    "description": "Show all params when using `--help`",
-                    "hidden": true,
-                    "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
-                },
-                "enable_conda": {
-                    "type": "boolean",
-                    "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-bacon"
-                }
-            }
-        },
-        "reference_genome_options": {
-            "title": "Reference genome options",
-            "type": "object",
-            "fa_icon": "fas fa-dna",
-            "description": "Reference genome related files and options required for the workflow.",
-            "properties": {
-                "genome": {
-                    "type": "string",
-                    "description": "Name of iGenomes reference.",
-                    "fa_icon": "fas fa-book",
-                    "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
-                    "hidden": true
-                },
-                "igenomes_base": {
-                    "type": "string",
-                    "format": "directory-path",
-                    "description": "Directory / URL base for iGenomes references.",
-                    "default": "s3://ngi-igenomes/igenomes",
-                    "fa_icon": "fas fa-cloud-download-alt",
-                    "hidden": true
-                },
-                "igenomes_ignore": {
-                    "type": "boolean",
-                    "description": "Do not load the iGenomes reference config.",
-                    "fa_icon": "fas fa-ban",
-                    "hidden": true,
-                    "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
-                }
-            }
+        "multiqc_title": {
+          "type": "string",
+          "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
+          "fa_icon": "fas fa-file-signature"
         }
+      }
     },
-    "allOf": [
-        {
-            "$ref": "#/definitions/input_output_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_general_qc_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_short_read_qc_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_long_read_qc_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_host_removal_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_run_merging_options"
-        },
-        {
-            "$ref": "#/definitions/profiling_options"
-        },
-        {
-            "$ref": "#/definitions/postprocessing_and_visualisation_options"
-        },
-        {
-            "$ref": "#/definitions/institutional_config_options"
-        },
-        {
-            "$ref": "#/definitions/max_job_request_options"
-        },
-        {
-            "$ref": "#/definitions/generic_options"
-        },
-        {
-            "$ref": "#/definitions/reference_genome_options"
+    "preprocessing_general_qc_options": {
+      "title": "Preprocessing general QC options",
+      "type": "object",
+      "description": "Common options across both long and short read preprocessing QC steps",
+      "default": "",
+      "properties": {
+        "save_preprocessed_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
+          "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
         }
-    ],
-    "properties": {
-        "preprocessing_qc_tool": {
-            "type": "string",
-            "default": "fastqc",
-            "enum": [
-                "fastqc",
-                "falco"
-            ],
-            "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
-            "description": "Specify the tool used for quality control of raw sequencing reads"
+      },
+      "fa_icon": "fas fa-users-cog"
+    },
+    "preprocessing_short_read_qc_options": {
+      "title": "Preprocessing short-read QC options",
+      "type": "object",
+      "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
+      "default": "",
+      "properties": {
+        "perform_shortread_qc": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
+          "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
         },
-        "save_mgc_counts": {
-            "type": "string",
-            "description": "Save the mgc reads count in mOTUs."
+        "shortread_qc_tool": {
+          "type": "string",
+          "default": "fastp",
+          "enum": ["fastp", "adapterremoval"],
+          "fa_icon": "fas fa-tools",
+          "description": "Specify which tool to use for short-read QC"
         },
-        "save_ncbi_id": {
-            "type": "string",
-            "description": "Print NCBI id in mOTUs."
+        "shortread_qc_skipadaptertrim": {
+          "type": "boolean",
+          "fa_icon": "fas fa-forward",
+          "description": "Skip adapter trimming",
+          "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
         },
-        "save_read_counts": {
-            "type": "string",
-            "description": "Print result as counts instead of relative abundances in mOTUs."
+        "shortread_qc_adapter1": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-grip-lines",
+          "description": "Specify adapter 1 nucleotide sequence",
+          "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
+        },
+        "shortread_qc_adapter2": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-grip-lines",
+          "description": "Specify adapter 2 nucleotide sequence",
+          "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
+        },
+        "shortread_qc_adapterlist": {
+          "type": "string",
+          "default": "None",
+          "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
+          "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
+        },
+        "shortread_qc_mergepairs": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on merging of read pairs for paired-end data",
+          "default": true,
+          "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
+        },
+        "shortread_qc_excludeunmerged": {
+          "type": "boolean",
+          "fa_icon": "far fa-times-circle",
+          "description": "Discard unmerged reads from paired-end merging",
+          "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
+        },
+        "shortread_qc_minlength": {
+          "type": "integer",
+          "default": 15,
+          "fa_icon": "fas fa-ruler-horizontal",
+          "description": "Specify the minimum length of reads to be retained",
+          "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
+        },
+        "perform_shortread_complexityfilter": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turns on nucleotide sequence complexity filtering",
+          "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
+        },
+        "shortread_complexityfilter_tool": {
+          "type": "string",
+          "default": "bbduk",
+          "enum": ["bbduk", "prinseqplusplus", "fastp"],
+          "fa_icon": "fas fa-hammer",
+          "description": "Specify which tool to use for complexity filtering"
+        },
+        "shortread_complexityfilter_entropy": {
+          "type": "number",
+          "default": 0.3,
+          "fa_icon": "fas fa-random",
+          "description": "Specify the minimum sequence entropy level for complexity filtering",
+          "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
+        },
+        "shortread_complexityfilter_bbduk_windowsize": {
+          "type": "integer",
+          "default": 50,
+          "fa_icon": "far fa-window-maximize",
+          "description": "Specify the window size for BBDuk complexity filtering",
+          "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
+        },
+        "shortread_complexityfilter_bbduk_mask": {
+          "type": "boolean",
+          "fa_icon": "fas fa-mask",
+          "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
+          "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
+        },
+        "shortread_complexityfilter_fastp_threshold": {
+          "type": "integer",
+          "default": 30,
+          "fa_icon": "fas fa-sort-numeric-down",
+          "description": "Specify the minimum complexity filter threshold of fastp",
+          "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
+        },
+        "shortread_complexityfilter_prinseqplusplus_mode": {
+          "type": "string",
+          "default": "entropy",
+          "enum": ["entropy", "dust"],
+          "fa_icon": "fas fa-check-square",
+          "description": "Specify the complexity filter mode for PRINSEQ++"
+        },
+        "shortread_complexityfilter_prinseqplusplus_dustscore": {
+          "type": "number",
+          "default": 0.5,
+          "fa_icon": "fas fa-head-side-mask",
+          "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
+          "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
+        },
+        "save_complexityfiltered_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save complexity filtered short-reads",
+          "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
         }
+      },
+      "fa_icon": "fas fa-compress-alt"
+    },
+    "preprocessing_long_read_qc_options": {
+      "title": "Preprocessing long-read QC options",
+      "type": "object",
+      "description": "Options for adapter clipping, quality trimming, and length filtering",
+      "default": "",
+      "properties": {
+        "perform_longread_qc": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
+          "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
+        },
+        "longread_qc_skipadaptertrim": {
+          "type": "boolean",
+          "description": "Skip long-read trimming",
+          "fa_icon": "fas fa-forward",
+          "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
+        },
+        "longread_qc_skipqualityfilter": {
+          "type": "boolean",
+          "description": "Skip long-read length and quality filtering",
+          "fa_icon": "fas fa-forward",
+          "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
+        },
+        "longread_qc_qualityfilter_minlength": {
+          "type": "integer",
+          "default": 1000,
+          "description": "Specify the minimum length of reads to be retained",
+          "fa_icon": "fas fa-ruler-horizontal",
+          "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
+        },
+        "longread_qc_qualityfilter_keeppercent": {
+          "type": "integer",
+          "default": 90,
+          "description": "Specify the percent of high-quality bases to be retained",
+          "fa_icon": "fas fa-percentage",
+          "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+        },
+        "longread_qc_qualityfilter_targetbases": {
+          "type": "integer",
+          "default": 500000000,
+          "description": "Specify the number of high-quality bases in the library to be retained",
+          "fa_icon": "fas fa-bullseye",
+          "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+        }
+      },
+      "fa_icon": "fas fa-expand-alt"
+    },
+    "preprocessing_host_removal_options": {
+      "title": "Preprocessing host removal options",
+      "type": "object",
+      "description": "Options for pre-profiling host read removal",
+      "default": "",
+      "properties": {
+        "perform_shortread_hostremoval": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on short-read host removal",
+          "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+        },
+        "perform_longread_hostremoval": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on long-read host removal",
+          "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+        },
+        "hostremoval_reference": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-file-alt",
+          "description": "Specify path to single reference FASTA of host(s) genome(s)",
+          "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
+        },
+        "shortread_hostremoval_index": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-address-book",
+          "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
+          "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+        },
+        "longread_hostremoval_index": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-address-book",
+          "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
+          "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+        },
+        "save_hostremoval_index": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save mapping index of input reference when not already supplied by user",
+          "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
+        },
+        "save_hostremoval_mapped": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save mapped reads in BAM format from host removal",
+          "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
+        },
+        "save_hostremoval_unmapped": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save unmapped reads in FASTQ format from host removal",
+          "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
+        }
+      },
+      "fa_icon": "fas fa-user-times"
+    },
+    "preprocessing_run_merging_options": {
+      "title": "Preprocessing run merging options",
+      "type": "object",
+      "description": "Options for per-sample run-merging",
+      "default": "",
+      "properties": {
+        "perform_runmerging": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on run merging",
+          "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
+        },
+        "save_runmerged_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save run-concatenated input FASTQ files for each sample",
+          "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
+        }
+      },
+      "fa_icon": "fas fa-clipboard-check"
+    },
+    "profiling_options": {
+      "title": "Profiling options",
+      "type": "object",
+      "description": "",
+      "default": "",
+      "properties": {
+        "run_centrifuge": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
+        },
+        "centrifuge_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of Centrifuge-aligned reads",
+          "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
+        },
+        "run_diamond": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
+        },
+        "diamond_output_format": {
+          "type": "string",
+          "default": "tsv",
+          "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
+          "fa_icon": "fas fa-file",
+          "description": "Specify output format from DIAMOND profiling.",
+          "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
+        },
+        "diamond_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
+          "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
+        },
+        "run_kaiju": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
+        },
+        "kaiju_taxon_rank": {
+          "type": "string",
+          "default": "species",
+          "enum": ["phylum", "class", "order", "family", "genus", "species"],
+          "fa_icon": "fas fa-tag",
+          "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
+          "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
+        },
+        "run_kraken2": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
+        },
+        "kraken2_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of Kraken2-aligned reads",
+          "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
+        },
+        "kraken2_save_readclassification": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
+          "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
+        },
+        "kraken2_save_minimizers": {
+          "type": "boolean",
+          "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
+          "fa_icon": "fas fa-save",
+          "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
+        },
+        "run_bracken": {
+          "type": "boolean",
+          "description": "Post-process kraken2 reports with Bracken.",
+          "fa_icon": "fas fa-toggle-on"
+        },
+        "run_malt": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
+        },
+        "malt_mode": {
+          "type": "string",
+          "default": "BlastN",
+          "fa_icon": "fas fa-check-square",
+          "description": "Specify which MALT alignment mode to use",
+          "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
+        },
+        "malt_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of MALT-aligned reads",
+          "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
+        },
+        "malt_generate_megansummary": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on generation of MEGAN summary file from MALT results",
+          "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
+        },
+        "run_metaphlan3": {
+          "type": "boolean",
+          "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
+          "fa_icon": "fas fa-toggle-on"
+        },
+        "run_motus": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
+        }
+      },
+      "fa_icon": "fas fa-align-center"
+    },
+    "postprocessing_and_visualisation_options": {
+      "title": "Postprocessing and visualisation options",
+      "type": "object",
+      "description": "",
+      "default": "",
+      "properties": {
+        "run_profile_standardisation": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on standardisation of taxon tables across profilers",
+          "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
+        },
+        "generate_biom_output": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
+          "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
+        },
+        "run_krona": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on generation of Krona plots for supported profilers",
+          "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
+        },
+        "krona_taxonomy_directory": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-folder-open",
+          "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
+          "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
+        }
+      },
+      "fa_icon": "fas fa-chart-line"
+    },
+    "institutional_config_options": {
+      "title": "Institutional config options",
+      "type": "object",
+      "fa_icon": "fas fa-university",
+      "description": "Parameters used to describe centralised config profiles. These should not be edited.",
+      "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
+      "properties": {
+        "custom_config_version": {
+          "type": "string",
+          "description": "Git commit id for Institutional configs.",
+          "default": "master",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "custom_config_base": {
+          "type": "string",
+          "description": "Base directory for Institutional configs.",
+          "default": "https://raw.githubusercontent.com/nf-core/configs/master",
+          "hidden": true,
+          "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_name": {
+          "type": "string",
+          "description": "Institutional config name.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_description": {
+          "type": "string",
+          "description": "Institutional config description.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_contact": {
+          "type": "string",
+          "description": "Institutional config contact information.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_url": {
+          "type": "string",
+          "description": "Institutional config URL link.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        }
+      }
+    },
+    "max_job_request_options": {
+      "title": "Max job request options",
+      "type": "object",
+      "fa_icon": "fab fa-acquisitions-incorporated",
+      "description": "Set the top limit for requested resources for any single job.",
+      "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
+      "properties": {
+        "max_cpus": {
+          "type": "integer",
+          "description": "Maximum number of CPUs that can be requested for any single job.",
+          "default": 16,
+          "fa_icon": "fas fa-microchip",
+          "hidden": true,
+          "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
+        },
+        "max_memory": {
+          "type": "string",
+          "description": "Maximum amount of memory that can be requested for any single job.",
+          "default": "128.GB",
+          "fa_icon": "fas fa-memory",
+          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+          "hidden": true,
+          "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
+        },
+        "max_time": {
+          "type": "string",
+          "description": "Maximum amount of time that can be requested for any single job.",
+          "default": "240.h",
+          "fa_icon": "far fa-clock",
+          "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
+          "hidden": true,
+          "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
+        }
+      }
+    },
+    "generic_options": {
+      "title": "Generic options",
+      "type": "object",
+      "fa_icon": "fas fa-file-import",
+      "description": "Less common options for the pipeline, typically set in a config file.",
+      "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
+      "properties": {
+        "help": {
+          "type": "boolean",
+          "description": "Display help text.",
+          "fa_icon": "fas fa-question-circle",
+          "hidden": true
+        },
+        "publish_dir_mode": {
+          "type": "string",
+          "default": "copy",
+          "description": "Method used to save pipeline results to output directory.",
+          "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
+          "fa_icon": "fas fa-copy",
+          "enum": [
+            "symlink",
+            "rellink",
+            "link",
+            "copy",
+            "copyNoFollow",
+            "move"
+          ],
+          "hidden": true
+        },
+        "email_on_fail": {
+          "type": "string",
+          "description": "Email address for completion summary, only when pipeline fails.",
+          "fa_icon": "fas fa-exclamation-triangle",
+          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
+          "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
+          "hidden": true
+        },
+        "plaintext_email": {
+          "type": "boolean",
+          "description": "Send plain-text email instead of HTML.",
+          "fa_icon": "fas fa-remove-format",
+          "hidden": true
+        },
+        "max_multiqc_email_size": {
+          "type": "string",
+          "description": "File size limit when attaching MultiQC reports to summary emails.",
+          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+          "default": "25.MB",
+          "fa_icon": "fas fa-file-upload",
+          "hidden": true
+        },
+        "monochrome_logs": {
+          "type": "boolean",
+          "description": "Do not use coloured log outputs.",
+          "fa_icon": "fas fa-palette",
+          "hidden": true
+        },
+        "hook_url": {
+          "type": "string",
+          "description": "Incoming hook URL for messaging service",
+          "fa_icon": "fas fa-people-group",
+          "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
+          "hidden": true
+        },
+        "multiqc_config": {
+          "type": "string",
+          "description": "Custom config file to supply to MultiQC.",
+          "fa_icon": "fas fa-cog",
+          "hidden": true
+        },
+        "multiqc_logo": {
+          "type": "string",
+          "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
+          "fa_icon": "fas fa-image",
+          "hidden": true
+        },
+        "multiqc_methods_description": {
+          "type": "string",
+          "description": "Custom MultiQC yaml file containing HTML including a methods description.",
+          "fa_icon": "fas fa-cog"
+        },
+        "tracedir": {
+          "type": "string",
+          "description": "Directory to keep pipeline Nextflow logs and reports.",
+          "default": "${params.outdir}/pipeline_info",
+          "fa_icon": "fas fa-cogs",
+          "hidden": true
+        },
+        "validate_params": {
+          "type": "boolean",
+          "description": "Boolean whether to validate parameters against the schema at runtime",
+          "default": true,
+          "fa_icon": "fas fa-check-square",
+          "hidden": true
+        },
+        "show_hidden_params": {
+          "type": "boolean",
+          "fa_icon": "far fa-eye-slash",
+          "description": "Show all params when using `--help`",
+          "hidden": true,
+          "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
+        },
+        "enable_conda": {
+          "type": "boolean",
+          "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
+          "hidden": true,
+          "fa_icon": "fas fa-bacon"
+        }
+      }
+    },
+    "reference_genome_options": {
+      "title": "Reference genome options",
+      "type": "object",
+      "fa_icon": "fas fa-dna",
+      "description": "Reference genome related files and options required for the workflow.",
+      "properties": {
+        "genome": {
+          "type": "string",
+          "description": "Name of iGenomes reference.",
+          "fa_icon": "fas fa-book",
+          "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
+          "hidden": true
+        },
+        "igenomes_base": {
+          "type": "string",
+          "format": "directory-path",
+          "description": "Directory / URL base for iGenomes references.",
+          "default": "s3://ngi-igenomes/igenomes",
+          "fa_icon": "fas fa-cloud-download-alt",
+          "hidden": true
+        },
+        "igenomes_ignore": {
+          "type": "boolean",
+          "description": "Do not load the iGenomes reference config.",
+          "fa_icon": "fas fa-ban",
+          "hidden": true,
+          "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
+        }
+      }
     }
-}
\ No newline at end of file
+  },
+  "allOf": [
+    {
+      "$ref": "#/definitions/input_output_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_general_qc_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_short_read_qc_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_long_read_qc_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_host_removal_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_run_merging_options"
+    },
+    {
+      "$ref": "#/definitions/profiling_options"
+    },
+    {
+      "$ref": "#/definitions/postprocessing_and_visualisation_options"
+    },
+    {
+      "$ref": "#/definitions/institutional_config_options"
+    },
+    {
+      "$ref": "#/definitions/max_job_request_options"
+    },
+    {
+      "$ref": "#/definitions/generic_options"
+    },
+    {
+      "$ref": "#/definitions/reference_genome_options"
+    }
+  ],
+  "properties": {
+    "preprocessing_qc_tool": {
+      "type": "string",
+      "default": "fastqc",
+      "enum": ["fastqc", "falco"],
+      "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
+      "description": "Specify the tool used for quality control of raw sequencing reads"
+    },
+    "save_mgc_counts": {
+      "type": "boolean",
+      "description": "Save the mgc reads count in mOTUs."
+    },
+    "save_ncbi_id": {
+      "type": "boolean",
+      "description": "Print NCBI id in mOTUs."
+    },
+    "save_read_counts": {
+      "type": "boolean",
+      "description": "Print result as counts instead of relative abundances in mOTUs."
+    }
+  }
+}

From 644a29c699fd4c9e9b1b500570342b795cfcbe4a Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 11:34:57 +0100
Subject: [PATCH 09/25] Prettier

---
 nextflow_schema.json | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index 58cab0c..cbe70b0 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -742,15 +742,15 @@
     },
     "save_mgc_counts": {
       "type": "boolean",
-      "description": "Save the mgc reads count in mOTUs."
+      "description": "Save the mgc reads count for mOTUs."
     },
     "save_ncbi_id": {
       "type": "boolean",
-      "description": "Print NCBI id in mOTUs."
+      "description": "Print NCBI taxonomic id for mOTUs."
     },
     "save_read_counts": {
       "type": "boolean",
-      "description": "Print result as counts instead of relative abundances in mOTUs."
+      "description": "Print mOTUs result as counts instead of relative abundances.."
     }
   }
 }

From fb6be69d7eefd55ec52f53daf6059ee59ffa2c4f Mon Sep 17 00:00:00 2001
From: Sofia Stamouli <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 11:37:20 +0100
Subject: [PATCH 10/25] Prettier should work now

---
 nextflow_schema.json | 1477 +++++++++++++++++++++---------------------
 1 file changed, 735 insertions(+), 742 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index cbe70b0..e0b7fa6 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -1,756 +1,749 @@
 {
-  "$schema": "http://json-schema.org/draft-07/schema",
-  "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
-  "title": "nf-core/taxprofiler pipeline parameters",
-  "description": "Taxonomic profiling of shotgun metagenomic data",
-  "type": "object",
-  "definitions": {
-    "input_output_options": {
-      "title": "Input/output options",
-      "type": "object",
-      "fa_icon": "fas fa-terminal",
-      "description": "Define where the pipeline should find input data and save output data.",
-      "required": ["input", "databases", "outdir"],
-      "properties": {
-        "input": {
-          "type": "string",
-          "format": "file-path",
-          "mimetype": "text/csv",
-          "pattern": "^\\S+\\.(csv|yaml|yml)$",
-          "schema": "assets/schema_input.json",
-          "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
-          "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
-          "fa_icon": "fas fa-file-csv"
+    "$schema": "http://json-schema.org/draft-07/schema",
+    "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
+    "title": "nf-core/taxprofiler pipeline parameters",
+    "description": "Taxonomic profiling of shotgun metagenomic data",
+    "type": "object",
+    "definitions": {
+        "input_output_options": {
+            "title": "Input/output options",
+            "type": "object",
+            "fa_icon": "fas fa-terminal",
+            "description": "Define where the pipeline should find input data and save output data.",
+            "required": ["input", "databases", "outdir"],
+            "properties": {
+                "input": {
+                    "type": "string",
+                    "format": "file-path",
+                    "mimetype": "text/csv",
+                    "pattern": "^\\S+\\.(csv|yaml|yml)$",
+                    "schema": "assets/schema_input.json",
+                    "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
+                    "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
+                    "fa_icon": "fas fa-file-csv"
+                },
+                "databases": {
+                    "type": "string",
+                    "mimetype": "text/csv",
+                    "format": "file-path",
+                    "fa_icon": "fas fa-database",
+                    "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
+                    "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
+                },
+                "outdir": {
+                    "type": "string",
+                    "format": "directory-path",
+                    "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
+                    "fa_icon": "fas fa-folder-open"
+                },
+                "email": {
+                    "type": "string",
+                    "description": "Email address for completion summary.",
+                    "fa_icon": "fas fa-envelope",
+                    "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
+                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
+                },
+                "multiqc_title": {
+                    "type": "string",
+                    "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
+                    "fa_icon": "fas fa-file-signature"
+                }
+            }
         },
-        "databases": {
-          "type": "string",
-          "mimetype": "text/csv",
-          "format": "file-path",
-          "fa_icon": "fas fa-database",
-          "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
-          "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
+        "preprocessing_general_qc_options": {
+            "title": "Preprocessing general QC options",
+            "type": "object",
+            "description": "Common options across both long and short read preprocessing QC steps",
+            "default": "",
+            "properties": {
+                "save_preprocessed_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
+                    "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
+                }
+            },
+            "fa_icon": "fas fa-users-cog"
         },
-        "outdir": {
-          "type": "string",
-          "format": "directory-path",
-          "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
-          "fa_icon": "fas fa-folder-open"
+        "preprocessing_short_read_qc_options": {
+            "title": "Preprocessing short-read QC options",
+            "type": "object",
+            "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
+            "default": "",
+            "properties": {
+                "perform_shortread_qc": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
+                    "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
+                },
+                "shortread_qc_tool": {
+                    "type": "string",
+                    "default": "fastp",
+                    "enum": ["fastp", "adapterremoval"],
+                    "fa_icon": "fas fa-tools",
+                    "description": "Specify which tool to use for short-read QC"
+                },
+                "shortread_qc_skipadaptertrim": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-forward",
+                    "description": "Skip adapter trimming",
+                    "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
+                },
+                "shortread_qc_adapter1": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-grip-lines",
+                    "description": "Specify adapter 1 nucleotide sequence",
+                    "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
+                },
+                "shortread_qc_adapter2": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-grip-lines",
+                    "description": "Specify adapter 2 nucleotide sequence",
+                    "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
+                },
+                "shortread_qc_adapterlist": {
+                    "type": "string",
+                    "default": "None",
+                    "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
+                    "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
+                },
+                "shortread_qc_mergepairs": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on merging of read pairs for paired-end data",
+                    "default": true,
+                    "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
+                },
+                "shortread_qc_excludeunmerged": {
+                    "type": "boolean",
+                    "fa_icon": "far fa-times-circle",
+                    "description": "Discard unmerged reads from paired-end merging",
+                    "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
+                },
+                "shortread_qc_minlength": {
+                    "type": "integer",
+                    "default": 15,
+                    "fa_icon": "fas fa-ruler-horizontal",
+                    "description": "Specify the minimum length of reads to be retained",
+                    "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
+                },
+                "perform_shortread_complexityfilter": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turns on nucleotide sequence complexity filtering",
+                    "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
+                },
+                "shortread_complexityfilter_tool": {
+                    "type": "string",
+                    "default": "bbduk",
+                    "enum": ["bbduk", "prinseqplusplus", "fastp"],
+                    "fa_icon": "fas fa-hammer",
+                    "description": "Specify which tool to use for complexity filtering"
+                },
+                "shortread_complexityfilter_entropy": {
+                    "type": "number",
+                    "default": 0.3,
+                    "fa_icon": "fas fa-random",
+                    "description": "Specify the minimum sequence entropy level for complexity filtering",
+                    "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
+                },
+                "shortread_complexityfilter_bbduk_windowsize": {
+                    "type": "integer",
+                    "default": 50,
+                    "fa_icon": "far fa-window-maximize",
+                    "description": "Specify the window size for BBDuk complexity filtering",
+                    "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
+                },
+                "shortread_complexityfilter_bbduk_mask": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-mask",
+                    "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
+                    "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
+                },
+                "shortread_complexityfilter_fastp_threshold": {
+                    "type": "integer",
+                    "default": 30,
+                    "fa_icon": "fas fa-sort-numeric-down",
+                    "description": "Specify the minimum complexity filter threshold of fastp",
+                    "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
+                },
+                "shortread_complexityfilter_prinseqplusplus_mode": {
+                    "type": "string",
+                    "default": "entropy",
+                    "enum": ["entropy", "dust"],
+                    "fa_icon": "fas fa-check-square",
+                    "description": "Specify the complexity filter mode for PRINSEQ++"
+                },
+                "shortread_complexityfilter_prinseqplusplus_dustscore": {
+                    "type": "number",
+                    "default": 0.5,
+                    "fa_icon": "fas fa-head-side-mask",
+                    "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
+                    "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
+                },
+                "save_complexityfiltered_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save complexity filtered short-reads",
+                    "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
+                }
+            },
+            "fa_icon": "fas fa-compress-alt"
         },
-        "email": {
-          "type": "string",
-          "description": "Email address for completion summary.",
-          "fa_icon": "fas fa-envelope",
-          "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
-          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
+        "preprocessing_long_read_qc_options": {
+            "title": "Preprocessing long-read QC options",
+            "type": "object",
+            "description": "Options for adapter clipping, quality trimming, and length filtering",
+            "default": "",
+            "properties": {
+                "perform_longread_qc": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
+                    "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
+                },
+                "longread_qc_skipadaptertrim": {
+                    "type": "boolean",
+                    "description": "Skip long-read trimming",
+                    "fa_icon": "fas fa-forward",
+                    "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
+                },
+                "longread_qc_skipqualityfilter": {
+                    "type": "boolean",
+                    "description": "Skip long-read length and quality filtering",
+                    "fa_icon": "fas fa-forward",
+                    "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
+                },
+                "longread_qc_qualityfilter_minlength": {
+                    "type": "integer",
+                    "default": 1000,
+                    "description": "Specify the minimum length of reads to be retained",
+                    "fa_icon": "fas fa-ruler-horizontal",
+                    "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
+                },
+                "longread_qc_qualityfilter_keeppercent": {
+                    "type": "integer",
+                    "default": 90,
+                    "description": "Specify the percent of high-quality bases to be retained",
+                    "fa_icon": "fas fa-percentage",
+                    "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+                },
+                "longread_qc_qualityfilter_targetbases": {
+                    "type": "integer",
+                    "default": 500000000,
+                    "description": "Specify the number of high-quality bases in the library to be retained",
+                    "fa_icon": "fas fa-bullseye",
+                    "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+                }
+            },
+            "fa_icon": "fas fa-expand-alt"
         },
-        "multiqc_title": {
-          "type": "string",
-          "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
-          "fa_icon": "fas fa-file-signature"
+        "preprocessing_host_removal_options": {
+            "title": "Preprocessing host removal options",
+            "type": "object",
+            "description": "Options for pre-profiling host read removal",
+            "default": "",
+            "properties": {
+                "perform_shortread_hostremoval": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on short-read host removal",
+                    "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+                },
+                "perform_longread_hostremoval": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on long-read host removal",
+                    "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+                },
+                "hostremoval_reference": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-file-alt",
+                    "description": "Specify path to single reference FASTA of host(s) genome(s)",
+                    "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
+                },
+                "shortread_hostremoval_index": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-address-book",
+                    "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
+                    "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+                },
+                "longread_hostremoval_index": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-address-book",
+                    "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
+                    "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+                },
+                "save_hostremoval_index": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save mapping index of input reference when not already supplied by user",
+                    "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
+                },
+                "save_hostremoval_mapped": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save mapped reads in BAM format from host removal",
+                    "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
+                },
+                "save_hostremoval_unmapped": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save unmapped reads in FASTQ format from host removal",
+                    "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
+                }
+            },
+            "fa_icon": "fas fa-user-times"
+        },
+        "preprocessing_run_merging_options": {
+            "title": "Preprocessing run merging options",
+            "type": "object",
+            "description": "Options for per-sample run-merging",
+            "default": "",
+            "properties": {
+                "perform_runmerging": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on run merging",
+                    "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
+                },
+                "save_runmerged_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save run-concatenated input FASTQ files for each sample",
+                    "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
+                }
+            },
+            "fa_icon": "fas fa-clipboard-check"
+        },
+        "profiling_options": {
+            "title": "Profiling options",
+            "type": "object",
+            "description": "",
+            "default": "",
+            "properties": {
+                "run_centrifuge": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
+                },
+                "centrifuge_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of Centrifuge-aligned reads",
+                    "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
+                },
+                "run_diamond": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
+                },
+                "diamond_output_format": {
+                    "type": "string",
+                    "default": "tsv",
+                    "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
+                    "fa_icon": "fas fa-file",
+                    "description": "Specify output format from DIAMOND profiling.",
+                    "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
+                },
+                "diamond_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
+                    "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
+                },
+                "run_kaiju": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
+                },
+                "kaiju_taxon_rank": {
+                    "type": "string",
+                    "default": "species",
+                    "enum": ["phylum", "class", "order", "family", "genus", "species"],
+                    "fa_icon": "fas fa-tag",
+                    "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
+                    "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
+                },
+                "run_kraken2": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
+                },
+                "kraken2_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of Kraken2-aligned reads",
+                    "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
+                },
+                "kraken2_save_readclassification": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
+                    "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
+                },
+                "kraken2_save_minimizers": {
+                    "type": "boolean",
+                    "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
+                    "fa_icon": "fas fa-save",
+                    "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
+                },
+                "run_bracken": {
+                    "type": "boolean",
+                    "description": "Post-process kraken2 reports with Bracken.",
+                    "fa_icon": "fas fa-toggle-on"
+                },
+                "run_malt": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
+                },
+                "malt_mode": {
+                    "type": "string",
+                    "default": "BlastN",
+                    "fa_icon": "fas fa-check-square",
+                    "description": "Specify which MALT alignment mode to use",
+                    "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
+                },
+                "malt_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of MALT-aligned reads",
+                    "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
+                },
+                "malt_generate_megansummary": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on generation of MEGAN summary file from MALT results",
+                    "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
+                },
+                "run_metaphlan3": {
+                    "type": "boolean",
+                    "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
+                    "fa_icon": "fas fa-toggle-on"
+                },
+                "run_motus": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
+                }
+            },
+            "fa_icon": "fas fa-align-center"
+        },
+        "postprocessing_and_visualisation_options": {
+            "title": "Postprocessing and visualisation options",
+            "type": "object",
+            "description": "",
+            "default": "",
+            "properties": {
+                "run_profile_standardisation": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on standardisation of taxon tables across profilers",
+                    "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
+                },
+                "generate_biom_output": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
+                    "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
+                },
+                "run_krona": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on generation of Krona plots for supported profilers",
+                    "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
+                },
+                "krona_taxonomy_directory": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-folder-open",
+                    "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
+                    "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
+                }
+            },
+            "fa_icon": "fas fa-chart-line"
+        },
+        "institutional_config_options": {
+            "title": "Institutional config options",
+            "type": "object",
+            "fa_icon": "fas fa-university",
+            "description": "Parameters used to describe centralised config profiles. These should not be edited.",
+            "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
+            "properties": {
+                "custom_config_version": {
+                    "type": "string",
+                    "description": "Git commit id for Institutional configs.",
+                    "default": "master",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "custom_config_base": {
+                    "type": "string",
+                    "description": "Base directory for Institutional configs.",
+                    "default": "https://raw.githubusercontent.com/nf-core/configs/master",
+                    "hidden": true,
+                    "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_name": {
+                    "type": "string",
+                    "description": "Institutional config name.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_description": {
+                    "type": "string",
+                    "description": "Institutional config description.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_contact": {
+                    "type": "string",
+                    "description": "Institutional config contact information.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_url": {
+                    "type": "string",
+                    "description": "Institutional config URL link.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                }
+            }
+        },
+        "max_job_request_options": {
+            "title": "Max job request options",
+            "type": "object",
+            "fa_icon": "fab fa-acquisitions-incorporated",
+            "description": "Set the top limit for requested resources for any single job.",
+            "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
+            "properties": {
+                "max_cpus": {
+                    "type": "integer",
+                    "description": "Maximum number of CPUs that can be requested for any single job.",
+                    "default": 16,
+                    "fa_icon": "fas fa-microchip",
+                    "hidden": true,
+                    "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
+                },
+                "max_memory": {
+                    "type": "string",
+                    "description": "Maximum amount of memory that can be requested for any single job.",
+                    "default": "128.GB",
+                    "fa_icon": "fas fa-memory",
+                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+                    "hidden": true,
+                    "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
+                },
+                "max_time": {
+                    "type": "string",
+                    "description": "Maximum amount of time that can be requested for any single job.",
+                    "default": "240.h",
+                    "fa_icon": "far fa-clock",
+                    "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
+                    "hidden": true,
+                    "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
+                }
+            }
+        },
+        "generic_options": {
+            "title": "Generic options",
+            "type": "object",
+            "fa_icon": "fas fa-file-import",
+            "description": "Less common options for the pipeline, typically set in a config file.",
+            "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
+            "properties": {
+                "help": {
+                    "type": "boolean",
+                    "description": "Display help text.",
+                    "fa_icon": "fas fa-question-circle",
+                    "hidden": true
+                },
+                "publish_dir_mode": {
+                    "type": "string",
+                    "default": "copy",
+                    "description": "Method used to save pipeline results to output directory.",
+                    "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
+                    "fa_icon": "fas fa-copy",
+                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
+                    "hidden": true
+                },
+                "email_on_fail": {
+                    "type": "string",
+                    "description": "Email address for completion summary, only when pipeline fails.",
+                    "fa_icon": "fas fa-exclamation-triangle",
+                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
+                    "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
+                    "hidden": true
+                },
+                "plaintext_email": {
+                    "type": "boolean",
+                    "description": "Send plain-text email instead of HTML.",
+                    "fa_icon": "fas fa-remove-format",
+                    "hidden": true
+                },
+                "max_multiqc_email_size": {
+                    "type": "string",
+                    "description": "File size limit when attaching MultiQC reports to summary emails.",
+                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+                    "default": "25.MB",
+                    "fa_icon": "fas fa-file-upload",
+                    "hidden": true
+                },
+                "monochrome_logs": {
+                    "type": "boolean",
+                    "description": "Do not use coloured log outputs.",
+                    "fa_icon": "fas fa-palette",
+                    "hidden": true
+                },
+                "hook_url": {
+                    "type": "string",
+                    "description": "Incoming hook URL for messaging service",
+                    "fa_icon": "fas fa-people-group",
+                    "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
+                    "hidden": true
+                },
+                "multiqc_config": {
+                    "type": "string",
+                    "description": "Custom config file to supply to MultiQC.",
+                    "fa_icon": "fas fa-cog",
+                    "hidden": true
+                },
+                "multiqc_logo": {
+                    "type": "string",
+                    "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
+                    "fa_icon": "fas fa-image",
+                    "hidden": true
+                },
+                "multiqc_methods_description": {
+                    "type": "string",
+                    "description": "Custom MultiQC yaml file containing HTML including a methods description.",
+                    "fa_icon": "fas fa-cog"
+                },
+                "tracedir": {
+                    "type": "string",
+                    "description": "Directory to keep pipeline Nextflow logs and reports.",
+                    "default": "${params.outdir}/pipeline_info",
+                    "fa_icon": "fas fa-cogs",
+                    "hidden": true
+                },
+                "validate_params": {
+                    "type": "boolean",
+                    "description": "Boolean whether to validate parameters against the schema at runtime",
+                    "default": true,
+                    "fa_icon": "fas fa-check-square",
+                    "hidden": true
+                },
+                "show_hidden_params": {
+                    "type": "boolean",
+                    "fa_icon": "far fa-eye-slash",
+                    "description": "Show all params when using `--help`",
+                    "hidden": true,
+                    "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
+                },
+                "enable_conda": {
+                    "type": "boolean",
+                    "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-bacon"
+                }
+            }
+        },
+        "reference_genome_options": {
+            "title": "Reference genome options",
+            "type": "object",
+            "fa_icon": "fas fa-dna",
+            "description": "Reference genome related files and options required for the workflow.",
+            "properties": {
+                "genome": {
+                    "type": "string",
+                    "description": "Name of iGenomes reference.",
+                    "fa_icon": "fas fa-book",
+                    "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
+                    "hidden": true
+                },
+                "igenomes_base": {
+                    "type": "string",
+                    "format": "directory-path",
+                    "description": "Directory / URL base for iGenomes references.",
+                    "default": "s3://ngi-igenomes/igenomes",
+                    "fa_icon": "fas fa-cloud-download-alt",
+                    "hidden": true
+                },
+                "igenomes_ignore": {
+                    "type": "boolean",
+                    "description": "Do not load the iGenomes reference config.",
+                    "fa_icon": "fas fa-ban",
+                    "hidden": true,
+                    "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
+                }
+            }
         }
-      }
     },
-    "preprocessing_general_qc_options": {
-      "title": "Preprocessing general QC options",
-      "type": "object",
-      "description": "Common options across both long and short read preprocessing QC steps",
-      "default": "",
-      "properties": {
-        "save_preprocessed_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
-          "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
+    "allOf": [
+        {
+            "$ref": "#/definitions/input_output_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_general_qc_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_short_read_qc_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_long_read_qc_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_host_removal_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_run_merging_options"
+        },
+        {
+            "$ref": "#/definitions/profiling_options"
+        },
+        {
+            "$ref": "#/definitions/postprocessing_and_visualisation_options"
+        },
+        {
+            "$ref": "#/definitions/institutional_config_options"
+        },
+        {
+            "$ref": "#/definitions/max_job_request_options"
+        },
+        {
+            "$ref": "#/definitions/generic_options"
+        },
+        {
+            "$ref": "#/definitions/reference_genome_options"
         }
-      },
-      "fa_icon": "fas fa-users-cog"
-    },
-    "preprocessing_short_read_qc_options": {
-      "title": "Preprocessing short-read QC options",
-      "type": "object",
-      "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
-      "default": "",
-      "properties": {
-        "perform_shortread_qc": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
-          "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
+    ],
+    "properties": {
+        "preprocessing_qc_tool": {
+            "type": "string",
+            "default": "fastqc",
+            "enum": ["fastqc", "falco"],
+            "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
+            "description": "Specify the tool used for quality control of raw sequencing reads"
         },
-        "shortread_qc_tool": {
-          "type": "string",
-          "default": "fastp",
-          "enum": ["fastp", "adapterremoval"],
-          "fa_icon": "fas fa-tools",
-          "description": "Specify which tool to use for short-read QC"
+        "save_mgc_counts": {
+            "type": "boolean",
+            "description": "Save the mgc reads count for mOTUs."
         },
-        "shortread_qc_skipadaptertrim": {
-          "type": "boolean",
-          "fa_icon": "fas fa-forward",
-          "description": "Skip adapter trimming",
-          "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
+        "save_ncbi_id": {
+            "type": "boolean",
+            "description": "Print NCBI taxonomic id for mOTUs."
         },
-        "shortread_qc_adapter1": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-grip-lines",
-          "description": "Specify adapter 1 nucleotide sequence",
-          "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
-        },
-        "shortread_qc_adapter2": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-grip-lines",
-          "description": "Specify adapter 2 nucleotide sequence",
-          "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
-        },
-        "shortread_qc_adapterlist": {
-          "type": "string",
-          "default": "None",
-          "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
-          "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
-        },
-        "shortread_qc_mergepairs": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on merging of read pairs for paired-end data",
-          "default": true,
-          "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
-        },
-        "shortread_qc_excludeunmerged": {
-          "type": "boolean",
-          "fa_icon": "far fa-times-circle",
-          "description": "Discard unmerged reads from paired-end merging",
-          "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
-        },
-        "shortread_qc_minlength": {
-          "type": "integer",
-          "default": 15,
-          "fa_icon": "fas fa-ruler-horizontal",
-          "description": "Specify the minimum length of reads to be retained",
-          "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
-        },
-        "perform_shortread_complexityfilter": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turns on nucleotide sequence complexity filtering",
-          "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
-        },
-        "shortread_complexityfilter_tool": {
-          "type": "string",
-          "default": "bbduk",
-          "enum": ["bbduk", "prinseqplusplus", "fastp"],
-          "fa_icon": "fas fa-hammer",
-          "description": "Specify which tool to use for complexity filtering"
-        },
-        "shortread_complexityfilter_entropy": {
-          "type": "number",
-          "default": 0.3,
-          "fa_icon": "fas fa-random",
-          "description": "Specify the minimum sequence entropy level for complexity filtering",
-          "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
-        },
-        "shortread_complexityfilter_bbduk_windowsize": {
-          "type": "integer",
-          "default": 50,
-          "fa_icon": "far fa-window-maximize",
-          "description": "Specify the window size for BBDuk complexity filtering",
-          "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
-        },
-        "shortread_complexityfilter_bbduk_mask": {
-          "type": "boolean",
-          "fa_icon": "fas fa-mask",
-          "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
-          "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
-        },
-        "shortread_complexityfilter_fastp_threshold": {
-          "type": "integer",
-          "default": 30,
-          "fa_icon": "fas fa-sort-numeric-down",
-          "description": "Specify the minimum complexity filter threshold of fastp",
-          "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
-        },
-        "shortread_complexityfilter_prinseqplusplus_mode": {
-          "type": "string",
-          "default": "entropy",
-          "enum": ["entropy", "dust"],
-          "fa_icon": "fas fa-check-square",
-          "description": "Specify the complexity filter mode for PRINSEQ++"
-        },
-        "shortread_complexityfilter_prinseqplusplus_dustscore": {
-          "type": "number",
-          "default": 0.5,
-          "fa_icon": "fas fa-head-side-mask",
-          "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
-          "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
-        },
-        "save_complexityfiltered_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save complexity filtered short-reads",
-          "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
+        "save_read_counts": {
+            "type": "boolean",
+            "description": "Print mOTUs result as counts instead of relative abundances.."
         }
-      },
-      "fa_icon": "fas fa-compress-alt"
-    },
-    "preprocessing_long_read_qc_options": {
-      "title": "Preprocessing long-read QC options",
-      "type": "object",
-      "description": "Options for adapter clipping, quality trimming, and length filtering",
-      "default": "",
-      "properties": {
-        "perform_longread_qc": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
-          "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
-        },
-        "longread_qc_skipadaptertrim": {
-          "type": "boolean",
-          "description": "Skip long-read trimming",
-          "fa_icon": "fas fa-forward",
-          "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
-        },
-        "longread_qc_skipqualityfilter": {
-          "type": "boolean",
-          "description": "Skip long-read length and quality filtering",
-          "fa_icon": "fas fa-forward",
-          "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
-        },
-        "longread_qc_qualityfilter_minlength": {
-          "type": "integer",
-          "default": 1000,
-          "description": "Specify the minimum length of reads to be retained",
-          "fa_icon": "fas fa-ruler-horizontal",
-          "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
-        },
-        "longread_qc_qualityfilter_keeppercent": {
-          "type": "integer",
-          "default": 90,
-          "description": "Specify the percent of high-quality bases to be retained",
-          "fa_icon": "fas fa-percentage",
-          "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-        },
-        "longread_qc_qualityfilter_targetbases": {
-          "type": "integer",
-          "default": 500000000,
-          "description": "Specify the number of high-quality bases in the library to be retained",
-          "fa_icon": "fas fa-bullseye",
-          "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-        }
-      },
-      "fa_icon": "fas fa-expand-alt"
-    },
-    "preprocessing_host_removal_options": {
-      "title": "Preprocessing host removal options",
-      "type": "object",
-      "description": "Options for pre-profiling host read removal",
-      "default": "",
-      "properties": {
-        "perform_shortread_hostremoval": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on short-read host removal",
-          "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-        },
-        "perform_longread_hostremoval": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on long-read host removal",
-          "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-        },
-        "hostremoval_reference": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-file-alt",
-          "description": "Specify path to single reference FASTA of host(s) genome(s)",
-          "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
-        },
-        "shortread_hostremoval_index": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-address-book",
-          "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
-          "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-        },
-        "longread_hostremoval_index": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-address-book",
-          "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
-          "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-        },
-        "save_hostremoval_index": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save mapping index of input reference when not already supplied by user",
-          "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
-        },
-        "save_hostremoval_mapped": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save mapped reads in BAM format from host removal",
-          "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
-        },
-        "save_hostremoval_unmapped": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save unmapped reads in FASTQ format from host removal",
-          "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
-        }
-      },
-      "fa_icon": "fas fa-user-times"
-    },
-    "preprocessing_run_merging_options": {
-      "title": "Preprocessing run merging options",
-      "type": "object",
-      "description": "Options for per-sample run-merging",
-      "default": "",
-      "properties": {
-        "perform_runmerging": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on run merging",
-          "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
-        },
-        "save_runmerged_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save run-concatenated input FASTQ files for each sample",
-          "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
-        }
-      },
-      "fa_icon": "fas fa-clipboard-check"
-    },
-    "profiling_options": {
-      "title": "Profiling options",
-      "type": "object",
-      "description": "",
-      "default": "",
-      "properties": {
-        "run_centrifuge": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
-        },
-        "centrifuge_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of Centrifuge-aligned reads",
-          "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
-        },
-        "run_diamond": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
-        },
-        "diamond_output_format": {
-          "type": "string",
-          "default": "tsv",
-          "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
-          "fa_icon": "fas fa-file",
-          "description": "Specify output format from DIAMOND profiling.",
-          "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
-        },
-        "diamond_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
-          "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
-        },
-        "run_kaiju": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
-        },
-        "kaiju_taxon_rank": {
-          "type": "string",
-          "default": "species",
-          "enum": ["phylum", "class", "order", "family", "genus", "species"],
-          "fa_icon": "fas fa-tag",
-          "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
-          "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
-        },
-        "run_kraken2": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
-        },
-        "kraken2_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of Kraken2-aligned reads",
-          "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
-        },
-        "kraken2_save_readclassification": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
-          "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
-        },
-        "kraken2_save_minimizers": {
-          "type": "boolean",
-          "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
-          "fa_icon": "fas fa-save",
-          "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
-        },
-        "run_bracken": {
-          "type": "boolean",
-          "description": "Post-process kraken2 reports with Bracken.",
-          "fa_icon": "fas fa-toggle-on"
-        },
-        "run_malt": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
-        },
-        "malt_mode": {
-          "type": "string",
-          "default": "BlastN",
-          "fa_icon": "fas fa-check-square",
-          "description": "Specify which MALT alignment mode to use",
-          "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
-        },
-        "malt_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of MALT-aligned reads",
-          "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
-        },
-        "malt_generate_megansummary": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on generation of MEGAN summary file from MALT results",
-          "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
-        },
-        "run_metaphlan3": {
-          "type": "boolean",
-          "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
-          "fa_icon": "fas fa-toggle-on"
-        },
-        "run_motus": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
-        }
-      },
-      "fa_icon": "fas fa-align-center"
-    },
-    "postprocessing_and_visualisation_options": {
-      "title": "Postprocessing and visualisation options",
-      "type": "object",
-      "description": "",
-      "default": "",
-      "properties": {
-        "run_profile_standardisation": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on standardisation of taxon tables across profilers",
-          "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
-        },
-        "generate_biom_output": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
-          "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
-        },
-        "run_krona": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on generation of Krona plots for supported profilers",
-          "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
-        },
-        "krona_taxonomy_directory": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-folder-open",
-          "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
-          "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
-        }
-      },
-      "fa_icon": "fas fa-chart-line"
-    },
-    "institutional_config_options": {
-      "title": "Institutional config options",
-      "type": "object",
-      "fa_icon": "fas fa-university",
-      "description": "Parameters used to describe centralised config profiles. These should not be edited.",
-      "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
-      "properties": {
-        "custom_config_version": {
-          "type": "string",
-          "description": "Git commit id for Institutional configs.",
-          "default": "master",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "custom_config_base": {
-          "type": "string",
-          "description": "Base directory for Institutional configs.",
-          "default": "https://raw.githubusercontent.com/nf-core/configs/master",
-          "hidden": true,
-          "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_name": {
-          "type": "string",
-          "description": "Institutional config name.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_description": {
-          "type": "string",
-          "description": "Institutional config description.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_contact": {
-          "type": "string",
-          "description": "Institutional config contact information.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_url": {
-          "type": "string",
-          "description": "Institutional config URL link.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        }
-      }
-    },
-    "max_job_request_options": {
-      "title": "Max job request options",
-      "type": "object",
-      "fa_icon": "fab fa-acquisitions-incorporated",
-      "description": "Set the top limit for requested resources for any single job.",
-      "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
-      "properties": {
-        "max_cpus": {
-          "type": "integer",
-          "description": "Maximum number of CPUs that can be requested for any single job.",
-          "default": 16,
-          "fa_icon": "fas fa-microchip",
-          "hidden": true,
-          "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
-        },
-        "max_memory": {
-          "type": "string",
-          "description": "Maximum amount of memory that can be requested for any single job.",
-          "default": "128.GB",
-          "fa_icon": "fas fa-memory",
-          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-          "hidden": true,
-          "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
-        },
-        "max_time": {
-          "type": "string",
-          "description": "Maximum amount of time that can be requested for any single job.",
-          "default": "240.h",
-          "fa_icon": "far fa-clock",
-          "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
-          "hidden": true,
-          "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
-        }
-      }
-    },
-    "generic_options": {
-      "title": "Generic options",
-      "type": "object",
-      "fa_icon": "fas fa-file-import",
-      "description": "Less common options for the pipeline, typically set in a config file.",
-      "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
-      "properties": {
-        "help": {
-          "type": "boolean",
-          "description": "Display help text.",
-          "fa_icon": "fas fa-question-circle",
-          "hidden": true
-        },
-        "publish_dir_mode": {
-          "type": "string",
-          "default": "copy",
-          "description": "Method used to save pipeline results to output directory.",
-          "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
-          "fa_icon": "fas fa-copy",
-          "enum": [
-            "symlink",
-            "rellink",
-            "link",
-            "copy",
-            "copyNoFollow",
-            "move"
-          ],
-          "hidden": true
-        },
-        "email_on_fail": {
-          "type": "string",
-          "description": "Email address for completion summary, only when pipeline fails.",
-          "fa_icon": "fas fa-exclamation-triangle",
-          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
-          "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
-          "hidden": true
-        },
-        "plaintext_email": {
-          "type": "boolean",
-          "description": "Send plain-text email instead of HTML.",
-          "fa_icon": "fas fa-remove-format",
-          "hidden": true
-        },
-        "max_multiqc_email_size": {
-          "type": "string",
-          "description": "File size limit when attaching MultiQC reports to summary emails.",
-          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-          "default": "25.MB",
-          "fa_icon": "fas fa-file-upload",
-          "hidden": true
-        },
-        "monochrome_logs": {
-          "type": "boolean",
-          "description": "Do not use coloured log outputs.",
-          "fa_icon": "fas fa-palette",
-          "hidden": true
-        },
-        "hook_url": {
-          "type": "string",
-          "description": "Incoming hook URL for messaging service",
-          "fa_icon": "fas fa-people-group",
-          "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
-          "hidden": true
-        },
-        "multiqc_config": {
-          "type": "string",
-          "description": "Custom config file to supply to MultiQC.",
-          "fa_icon": "fas fa-cog",
-          "hidden": true
-        },
-        "multiqc_logo": {
-          "type": "string",
-          "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
-          "fa_icon": "fas fa-image",
-          "hidden": true
-        },
-        "multiqc_methods_description": {
-          "type": "string",
-          "description": "Custom MultiQC yaml file containing HTML including a methods description.",
-          "fa_icon": "fas fa-cog"
-        },
-        "tracedir": {
-          "type": "string",
-          "description": "Directory to keep pipeline Nextflow logs and reports.",
-          "default": "${params.outdir}/pipeline_info",
-          "fa_icon": "fas fa-cogs",
-          "hidden": true
-        },
-        "validate_params": {
-          "type": "boolean",
-          "description": "Boolean whether to validate parameters against the schema at runtime",
-          "default": true,
-          "fa_icon": "fas fa-check-square",
-          "hidden": true
-        },
-        "show_hidden_params": {
-          "type": "boolean",
-          "fa_icon": "far fa-eye-slash",
-          "description": "Show all params when using `--help`",
-          "hidden": true,
-          "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
-        },
-        "enable_conda": {
-          "type": "boolean",
-          "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
-          "hidden": true,
-          "fa_icon": "fas fa-bacon"
-        }
-      }
-    },
-    "reference_genome_options": {
-      "title": "Reference genome options",
-      "type": "object",
-      "fa_icon": "fas fa-dna",
-      "description": "Reference genome related files and options required for the workflow.",
-      "properties": {
-        "genome": {
-          "type": "string",
-          "description": "Name of iGenomes reference.",
-          "fa_icon": "fas fa-book",
-          "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
-          "hidden": true
-        },
-        "igenomes_base": {
-          "type": "string",
-          "format": "directory-path",
-          "description": "Directory / URL base for iGenomes references.",
-          "default": "s3://ngi-igenomes/igenomes",
-          "fa_icon": "fas fa-cloud-download-alt",
-          "hidden": true
-        },
-        "igenomes_ignore": {
-          "type": "boolean",
-          "description": "Do not load the iGenomes reference config.",
-          "fa_icon": "fas fa-ban",
-          "hidden": true,
-          "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
-        }
-      }
     }
-  },
-  "allOf": [
-    {
-      "$ref": "#/definitions/input_output_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_general_qc_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_short_read_qc_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_long_read_qc_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_host_removal_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_run_merging_options"
-    },
-    {
-      "$ref": "#/definitions/profiling_options"
-    },
-    {
-      "$ref": "#/definitions/postprocessing_and_visualisation_options"
-    },
-    {
-      "$ref": "#/definitions/institutional_config_options"
-    },
-    {
-      "$ref": "#/definitions/max_job_request_options"
-    },
-    {
-      "$ref": "#/definitions/generic_options"
-    },
-    {
-      "$ref": "#/definitions/reference_genome_options"
-    }
-  ],
-  "properties": {
-    "preprocessing_qc_tool": {
-      "type": "string",
-      "default": "fastqc",
-      "enum": ["fastqc", "falco"],
-      "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
-      "description": "Specify the tool used for quality control of raw sequencing reads"
-    },
-    "save_mgc_counts": {
-      "type": "boolean",
-      "description": "Save the mgc reads count for mOTUs."
-    },
-    "save_ncbi_id": {
-      "type": "boolean",
-      "description": "Print NCBI taxonomic id for mOTUs."
-    },
-    "save_read_counts": {
-      "type": "boolean",
-      "description": "Print mOTUs result as counts instead of relative abundances.."
-    }
-  }
 }

From 71b52b9c94a0e009a8ded36dd7ebf2351145adcc Mon Sep 17 00:00:00 2001
From: Sofia Stamouli <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 11:58:23 +0100
Subject: [PATCH 11/25] Apply review suggestions

---
 conf/modules.config  | 6 +++++-
 nextflow_schema.json | 2 +-
 2 files changed, 6 insertions(+), 2 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index 5c35525..8502ebe 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -446,7 +446,11 @@ process {
     }
 
     withName: MOTUS_PROFILE {
-        ext.args = { [ params.save_ncbi_id ? "-p" : "", params.save_read_counts ? "-c" : "", params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : "" ].join(',').replaceAll(','," ") }
+        ext.args = { [ 
+		params.save_ncbi_id ? "-p" : "",
+		params.save_read_counts ? "-c" : "",
+		params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
+	   ].join(',').replaceAll(','," ") }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
         publishDir = [
             path: { "${params.outdir}/motus/${meta.db_name}/" },
diff --git a/nextflow_schema.json b/nextflow_schema.json
index e0b7fa6..8e2250b 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -743,7 +743,7 @@
         },
         "save_read_counts": {
             "type": "boolean",
-            "description": "Print mOTUs result as counts instead of relative abundances.."
+            "description": "Print mOTUs result as counts instead of relative abundances."
         }
     }
 }

From ba727a81aef811faa91aa1f85a5e2a40b7101b3e Mon Sep 17 00:00:00 2001
From: Sofia Stamouli <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 12:45:14 +0100
Subject: [PATCH 12/25] Fix left-padding spaces

---
 conf/modules.config | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/conf/modules.config b/conf/modules.config
index 8502ebe..7327a2b 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -450,7 +450,7 @@ process {
 		params.save_ncbi_id ? "-p" : "",
 		params.save_read_counts ? "-c" : "",
 		params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
-	   ].join(',').replaceAll(','," ") }
+	].join(',').replaceAll(','," ") }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
         publishDir = [
             path: { "${params.outdir}/motus/${meta.db_name}/" },

From 770a35d7aca245ef12f9d820b90d639c398bdfb0 Mon Sep 17 00:00:00 2001
From: "James A. Fellows Yates" <jfy133@gmail.com>
Date: Tue, 29 Nov 2022 12:49:20 +0100
Subject: [PATCH 13/25] Update conf/modules.config

---
 conf/modules.config | 12 +++++++-----
 1 file changed, 7 insertions(+), 5 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index 7327a2b..9494e02 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -446,11 +446,13 @@ process {
     }
 
     withName: MOTUS_PROFILE {
-        ext.args = { [ 
-		params.save_ncbi_id ? "-p" : "",
-		params.save_read_counts ? "-c" : "",
-		params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
-	].join(',').replaceAll(','," ") }
+        ext.args = { 
+            [ 
+		        params.save_ncbi_id ? "-p" : "",
+		        params.save_read_counts ? "-c" : "",
+		        params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
+	        ].join(',').replaceAll(','," ")
+	    }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
         publishDir = [
             path: { "${params.outdir}/motus/${meta.db_name}/" },

From 0088b07220c502da5e568916e1d0e366f9992a26 Mon Sep 17 00:00:00 2001
From: Sofia Stamouli <91951607+sofstam@users.noreply.github.com>
Date: Tue, 29 Nov 2022 13:28:04 +0100
Subject: [PATCH 14/25] Fix trailing whitespace

---
 conf/modules.config | 10 +++++-----
 1 file changed, 5 insertions(+), 5 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index 9494e02..a2852d5 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -446,12 +446,12 @@ process {
     }
 
     withName: MOTUS_PROFILE {
-        ext.args = { 
+        ext.args = {
             [ 
-		        params.save_ncbi_id ? "-p" : "",
-		        params.save_read_counts ? "-c" : "",
-		        params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
-	        ].join(',').replaceAll(','," ")
+                params.save_ncbi_id ? "-p" : "",
+                params.save_read_counts ? "-c" : "",
+                params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
+            ].join(',').replaceAll(','," ")
 	    }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
         publishDir = [

From 7e3ece53bd9fd76660b8d1dcc499ea010a382ec1 Mon Sep 17 00:00:00 2001
From: Sofia Stamouli <91951607+sofstam@users.noreply.github.com>
Date: Tue, 29 Nov 2022 13:31:00 +0100
Subject: [PATCH 15/25] Update modules.config

---
 conf/modules.config | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index a2852d5..0f54301 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -447,12 +447,12 @@ process {
 
     withName: MOTUS_PROFILE {
         ext.args = {
-            [ 
+            [
                 params.save_ncbi_id ? "-p" : "",
                 params.save_read_counts ? "-c" : "",
                 params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
             ].join(',').replaceAll(','," ")
-	    }
+            }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
         publishDir = [
             path: { "${params.outdir}/motus/${meta.db_name}/" },

From f389029848e0044568ecc92c8cb004e5ada69653 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 14:38:39 +0100
Subject: [PATCH 16/25] Fix merge conflic

---
 nextflow_schema.json | 1475 +++++++++++++++++++++---------------------
 1 file changed, 741 insertions(+), 734 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index 8e2250b..df4b4e7 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -1,749 +1,756 @@
 {
-    "$schema": "http://json-schema.org/draft-07/schema",
-    "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
-    "title": "nf-core/taxprofiler pipeline parameters",
-    "description": "Taxonomic profiling of shotgun metagenomic data",
-    "type": "object",
-    "definitions": {
-        "input_output_options": {
-            "title": "Input/output options",
-            "type": "object",
-            "fa_icon": "fas fa-terminal",
-            "description": "Define where the pipeline should find input data and save output data.",
-            "required": ["input", "databases", "outdir"],
-            "properties": {
-                "input": {
-                    "type": "string",
-                    "format": "file-path",
-                    "mimetype": "text/csv",
-                    "pattern": "^\\S+\\.(csv|yaml|yml)$",
-                    "schema": "assets/schema_input.json",
-                    "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
-                    "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
-                    "fa_icon": "fas fa-file-csv"
-                },
-                "databases": {
-                    "type": "string",
-                    "mimetype": "text/csv",
-                    "format": "file-path",
-                    "fa_icon": "fas fa-database",
-                    "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
-                    "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
-                },
-                "outdir": {
-                    "type": "string",
-                    "format": "directory-path",
-                    "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
-                    "fa_icon": "fas fa-folder-open"
-                },
-                "email": {
-                    "type": "string",
-                    "description": "Email address for completion summary.",
-                    "fa_icon": "fas fa-envelope",
-                    "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
-                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
-                },
-                "multiqc_title": {
-                    "type": "string",
-                    "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
-                    "fa_icon": "fas fa-file-signature"
-                }
-            }
+  "$schema": "http://json-schema.org/draft-07/schema",
+  "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
+  "title": "nf-core/taxprofiler pipeline parameters",
+  "description": "Taxonomic profiling of shotgun metagenomic data",
+  "type": "object",
+  "definitions": {
+    "input_output_options": {
+      "title": "Input/output options",
+      "type": "object",
+      "fa_icon": "fas fa-terminal",
+      "description": "Define where the pipeline should find input data and save output data.",
+      "required": ["input", "databases", "outdir"],
+      "properties": {
+        "input": {
+          "type": "string",
+          "format": "file-path",
+          "mimetype": "text/csv",
+          "pattern": "^\\S+\\.(csv|yaml|yml)$",
+          "schema": "assets/schema_input.json",
+          "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
+          "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
+          "fa_icon": "fas fa-file-csv"
         },
-        "preprocessing_general_qc_options": {
-            "title": "Preprocessing general QC options",
-            "type": "object",
-            "description": "Common options across both long and short read preprocessing QC steps",
-            "default": "",
-            "properties": {
-                "save_preprocessed_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
-                    "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
-                }
-            },
-            "fa_icon": "fas fa-users-cog"
+        "databases": {
+          "type": "string",
+          "mimetype": "text/csv",
+          "format": "file-path",
+          "fa_icon": "fas fa-database",
+          "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
+          "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
         },
-        "preprocessing_short_read_qc_options": {
-            "title": "Preprocessing short-read QC options",
-            "type": "object",
-            "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
-            "default": "",
-            "properties": {
-                "perform_shortread_qc": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
-                    "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
-                },
-                "shortread_qc_tool": {
-                    "type": "string",
-                    "default": "fastp",
-                    "enum": ["fastp", "adapterremoval"],
-                    "fa_icon": "fas fa-tools",
-                    "description": "Specify which tool to use for short-read QC"
-                },
-                "shortread_qc_skipadaptertrim": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-forward",
-                    "description": "Skip adapter trimming",
-                    "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
-                },
-                "shortread_qc_adapter1": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-grip-lines",
-                    "description": "Specify adapter 1 nucleotide sequence",
-                    "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
-                },
-                "shortread_qc_adapter2": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-grip-lines",
-                    "description": "Specify adapter 2 nucleotide sequence",
-                    "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
-                },
-                "shortread_qc_adapterlist": {
-                    "type": "string",
-                    "default": "None",
-                    "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
-                    "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
-                },
-                "shortread_qc_mergepairs": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on merging of read pairs for paired-end data",
-                    "default": true,
-                    "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
-                },
-                "shortread_qc_excludeunmerged": {
-                    "type": "boolean",
-                    "fa_icon": "far fa-times-circle",
-                    "description": "Discard unmerged reads from paired-end merging",
-                    "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
-                },
-                "shortread_qc_minlength": {
-                    "type": "integer",
-                    "default": 15,
-                    "fa_icon": "fas fa-ruler-horizontal",
-                    "description": "Specify the minimum length of reads to be retained",
-                    "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
-                },
-                "perform_shortread_complexityfilter": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turns on nucleotide sequence complexity filtering",
-                    "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
-                },
-                "shortread_complexityfilter_tool": {
-                    "type": "string",
-                    "default": "bbduk",
-                    "enum": ["bbduk", "prinseqplusplus", "fastp"],
-                    "fa_icon": "fas fa-hammer",
-                    "description": "Specify which tool to use for complexity filtering"
-                },
-                "shortread_complexityfilter_entropy": {
-                    "type": "number",
-                    "default": 0.3,
-                    "fa_icon": "fas fa-random",
-                    "description": "Specify the minimum sequence entropy level for complexity filtering",
-                    "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
-                },
-                "shortread_complexityfilter_bbduk_windowsize": {
-                    "type": "integer",
-                    "default": 50,
-                    "fa_icon": "far fa-window-maximize",
-                    "description": "Specify the window size for BBDuk complexity filtering",
-                    "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
-                },
-                "shortread_complexityfilter_bbduk_mask": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-mask",
-                    "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
-                    "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
-                },
-                "shortread_complexityfilter_fastp_threshold": {
-                    "type": "integer",
-                    "default": 30,
-                    "fa_icon": "fas fa-sort-numeric-down",
-                    "description": "Specify the minimum complexity filter threshold of fastp",
-                    "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
-                },
-                "shortread_complexityfilter_prinseqplusplus_mode": {
-                    "type": "string",
-                    "default": "entropy",
-                    "enum": ["entropy", "dust"],
-                    "fa_icon": "fas fa-check-square",
-                    "description": "Specify the complexity filter mode for PRINSEQ++"
-                },
-                "shortread_complexityfilter_prinseqplusplus_dustscore": {
-                    "type": "number",
-                    "default": 0.5,
-                    "fa_icon": "fas fa-head-side-mask",
-                    "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
-                    "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
-                },
-                "save_complexityfiltered_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save complexity filtered short-reads",
-                    "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
-                }
-            },
-            "fa_icon": "fas fa-compress-alt"
+        "outdir": {
+          "type": "string",
+          "format": "directory-path",
+          "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
+          "fa_icon": "fas fa-folder-open"
         },
-        "preprocessing_long_read_qc_options": {
-            "title": "Preprocessing long-read QC options",
-            "type": "object",
-            "description": "Options for adapter clipping, quality trimming, and length filtering",
-            "default": "",
-            "properties": {
-                "perform_longread_qc": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
-                    "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
-                },
-                "longread_qc_skipadaptertrim": {
-                    "type": "boolean",
-                    "description": "Skip long-read trimming",
-                    "fa_icon": "fas fa-forward",
-                    "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
-                },
-                "longread_qc_skipqualityfilter": {
-                    "type": "boolean",
-                    "description": "Skip long-read length and quality filtering",
-                    "fa_icon": "fas fa-forward",
-                    "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
-                },
-                "longread_qc_qualityfilter_minlength": {
-                    "type": "integer",
-                    "default": 1000,
-                    "description": "Specify the minimum length of reads to be retained",
-                    "fa_icon": "fas fa-ruler-horizontal",
-                    "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
-                },
-                "longread_qc_qualityfilter_keeppercent": {
-                    "type": "integer",
-                    "default": 90,
-                    "description": "Specify the percent of high-quality bases to be retained",
-                    "fa_icon": "fas fa-percentage",
-                    "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-                },
-                "longread_qc_qualityfilter_targetbases": {
-                    "type": "integer",
-                    "default": 500000000,
-                    "description": "Specify the number of high-quality bases in the library to be retained",
-                    "fa_icon": "fas fa-bullseye",
-                    "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-                }
-            },
-            "fa_icon": "fas fa-expand-alt"
+        "email": {
+          "type": "string",
+          "description": "Email address for completion summary.",
+          "fa_icon": "fas fa-envelope",
+          "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
+          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
         },
-        "preprocessing_host_removal_options": {
-            "title": "Preprocessing host removal options",
-            "type": "object",
-            "description": "Options for pre-profiling host read removal",
-            "default": "",
-            "properties": {
-                "perform_shortread_hostremoval": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on short-read host removal",
-                    "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-                },
-                "perform_longread_hostremoval": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on long-read host removal",
-                    "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-                },
-                "hostremoval_reference": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-file-alt",
-                    "description": "Specify path to single reference FASTA of host(s) genome(s)",
-                    "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
-                },
-                "shortread_hostremoval_index": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-address-book",
-                    "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
-                    "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-                },
-                "longread_hostremoval_index": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-address-book",
-                    "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
-                    "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-                },
-                "save_hostremoval_index": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save mapping index of input reference when not already supplied by user",
-                    "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
-                },
-                "save_hostremoval_mapped": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save mapped reads in BAM format from host removal",
-                    "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
-                },
-                "save_hostremoval_unmapped": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save unmapped reads in FASTQ format from host removal",
-                    "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
-                }
-            },
-            "fa_icon": "fas fa-user-times"
-        },
-        "preprocessing_run_merging_options": {
-            "title": "Preprocessing run merging options",
-            "type": "object",
-            "description": "Options for per-sample run-merging",
-            "default": "",
-            "properties": {
-                "perform_runmerging": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on run merging",
-                    "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
-                },
-                "save_runmerged_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Save run-concatenated input FASTQ files for each sample",
-                    "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
-                }
-            },
-            "fa_icon": "fas fa-clipboard-check"
-        },
-        "profiling_options": {
-            "title": "Profiling options",
-            "type": "object",
-            "description": "",
-            "default": "",
-            "properties": {
-                "run_centrifuge": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
-                },
-                "centrifuge_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of Centrifuge-aligned reads",
-                    "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
-                },
-                "run_diamond": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
-                },
-                "diamond_output_format": {
-                    "type": "string",
-                    "default": "tsv",
-                    "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
-                    "fa_icon": "fas fa-file",
-                    "description": "Specify output format from DIAMOND profiling.",
-                    "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
-                },
-                "diamond_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
-                    "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
-                },
-                "run_kaiju": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
-                },
-                "kaiju_taxon_rank": {
-                    "type": "string",
-                    "default": "species",
-                    "enum": ["phylum", "class", "order", "family", "genus", "species"],
-                    "fa_icon": "fas fa-tag",
-                    "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
-                    "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
-                },
-                "run_kraken2": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
-                },
-                "kraken2_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of Kraken2-aligned reads",
-                    "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
-                },
-                "kraken2_save_readclassification": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
-                    "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
-                },
-                "kraken2_save_minimizers": {
-                    "type": "boolean",
-                    "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
-                    "fa_icon": "fas fa-save",
-                    "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
-                },
-                "run_bracken": {
-                    "type": "boolean",
-                    "description": "Post-process kraken2 reports with Bracken.",
-                    "fa_icon": "fas fa-toggle-on"
-                },
-                "run_malt": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
-                },
-                "malt_mode": {
-                    "type": "string",
-                    "default": "BlastN",
-                    "fa_icon": "fas fa-check-square",
-                    "description": "Specify which MALT alignment mode to use",
-                    "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
-                },
-                "malt_save_reads": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on saving of MALT-aligned reads",
-                    "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
-                },
-                "malt_generate_megansummary": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-save",
-                    "description": "Turn on generation of MEGAN summary file from MALT results",
-                    "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
-                },
-                "run_metaphlan3": {
-                    "type": "boolean",
-                    "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
-                    "fa_icon": "fas fa-toggle-on"
-                },
-                "run_motus": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
-                }
-            },
-            "fa_icon": "fas fa-align-center"
-        },
-        "postprocessing_and_visualisation_options": {
-            "title": "Postprocessing and visualisation options",
-            "type": "object",
-            "description": "",
-            "default": "",
-            "properties": {
-                "run_profile_standardisation": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on standardisation of taxon tables across profilers",
-                    "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
-                },
-                "generate_biom_output": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
-                    "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
-                },
-                "run_krona": {
-                    "type": "boolean",
-                    "fa_icon": "fas fa-toggle-on",
-                    "description": "Turn on generation of Krona plots for supported profilers",
-                    "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
-                },
-                "krona_taxonomy_directory": {
-                    "type": "string",
-                    "default": "None",
-                    "fa_icon": "fas fa-folder-open",
-                    "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
-                    "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
-                }
-            },
-            "fa_icon": "fas fa-chart-line"
-        },
-        "institutional_config_options": {
-            "title": "Institutional config options",
-            "type": "object",
-            "fa_icon": "fas fa-university",
-            "description": "Parameters used to describe centralised config profiles. These should not be edited.",
-            "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
-            "properties": {
-                "custom_config_version": {
-                    "type": "string",
-                    "description": "Git commit id for Institutional configs.",
-                    "default": "master",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "custom_config_base": {
-                    "type": "string",
-                    "description": "Base directory for Institutional configs.",
-                    "default": "https://raw.githubusercontent.com/nf-core/configs/master",
-                    "hidden": true,
-                    "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_name": {
-                    "type": "string",
-                    "description": "Institutional config name.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_description": {
-                    "type": "string",
-                    "description": "Institutional config description.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_contact": {
-                    "type": "string",
-                    "description": "Institutional config contact information.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                },
-                "config_profile_url": {
-                    "type": "string",
-                    "description": "Institutional config URL link.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-users-cog"
-                }
-            }
-        },
-        "max_job_request_options": {
-            "title": "Max job request options",
-            "type": "object",
-            "fa_icon": "fab fa-acquisitions-incorporated",
-            "description": "Set the top limit for requested resources for any single job.",
-            "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
-            "properties": {
-                "max_cpus": {
-                    "type": "integer",
-                    "description": "Maximum number of CPUs that can be requested for any single job.",
-                    "default": 16,
-                    "fa_icon": "fas fa-microchip",
-                    "hidden": true,
-                    "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
-                },
-                "max_memory": {
-                    "type": "string",
-                    "description": "Maximum amount of memory that can be requested for any single job.",
-                    "default": "128.GB",
-                    "fa_icon": "fas fa-memory",
-                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-                    "hidden": true,
-                    "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
-                },
-                "max_time": {
-                    "type": "string",
-                    "description": "Maximum amount of time that can be requested for any single job.",
-                    "default": "240.h",
-                    "fa_icon": "far fa-clock",
-                    "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
-                    "hidden": true,
-                    "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
-                }
-            }
-        },
-        "generic_options": {
-            "title": "Generic options",
-            "type": "object",
-            "fa_icon": "fas fa-file-import",
-            "description": "Less common options for the pipeline, typically set in a config file.",
-            "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
-            "properties": {
-                "help": {
-                    "type": "boolean",
-                    "description": "Display help text.",
-                    "fa_icon": "fas fa-question-circle",
-                    "hidden": true
-                },
-                "publish_dir_mode": {
-                    "type": "string",
-                    "default": "copy",
-                    "description": "Method used to save pipeline results to output directory.",
-                    "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
-                    "fa_icon": "fas fa-copy",
-                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
-                    "hidden": true
-                },
-                "email_on_fail": {
-                    "type": "string",
-                    "description": "Email address for completion summary, only when pipeline fails.",
-                    "fa_icon": "fas fa-exclamation-triangle",
-                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
-                    "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
-                    "hidden": true
-                },
-                "plaintext_email": {
-                    "type": "boolean",
-                    "description": "Send plain-text email instead of HTML.",
-                    "fa_icon": "fas fa-remove-format",
-                    "hidden": true
-                },
-                "max_multiqc_email_size": {
-                    "type": "string",
-                    "description": "File size limit when attaching MultiQC reports to summary emails.",
-                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-                    "default": "25.MB",
-                    "fa_icon": "fas fa-file-upload",
-                    "hidden": true
-                },
-                "monochrome_logs": {
-                    "type": "boolean",
-                    "description": "Do not use coloured log outputs.",
-                    "fa_icon": "fas fa-palette",
-                    "hidden": true
-                },
-                "hook_url": {
-                    "type": "string",
-                    "description": "Incoming hook URL for messaging service",
-                    "fa_icon": "fas fa-people-group",
-                    "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
-                    "hidden": true
-                },
-                "multiqc_config": {
-                    "type": "string",
-                    "description": "Custom config file to supply to MultiQC.",
-                    "fa_icon": "fas fa-cog",
-                    "hidden": true
-                },
-                "multiqc_logo": {
-                    "type": "string",
-                    "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
-                    "fa_icon": "fas fa-image",
-                    "hidden": true
-                },
-                "multiqc_methods_description": {
-                    "type": "string",
-                    "description": "Custom MultiQC yaml file containing HTML including a methods description.",
-                    "fa_icon": "fas fa-cog"
-                },
-                "tracedir": {
-                    "type": "string",
-                    "description": "Directory to keep pipeline Nextflow logs and reports.",
-                    "default": "${params.outdir}/pipeline_info",
-                    "fa_icon": "fas fa-cogs",
-                    "hidden": true
-                },
-                "validate_params": {
-                    "type": "boolean",
-                    "description": "Boolean whether to validate parameters against the schema at runtime",
-                    "default": true,
-                    "fa_icon": "fas fa-check-square",
-                    "hidden": true
-                },
-                "show_hidden_params": {
-                    "type": "boolean",
-                    "fa_icon": "far fa-eye-slash",
-                    "description": "Show all params when using `--help`",
-                    "hidden": true,
-                    "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
-                },
-                "enable_conda": {
-                    "type": "boolean",
-                    "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
-                    "hidden": true,
-                    "fa_icon": "fas fa-bacon"
-                }
-            }
-        },
-        "reference_genome_options": {
-            "title": "Reference genome options",
-            "type": "object",
-            "fa_icon": "fas fa-dna",
-            "description": "Reference genome related files and options required for the workflow.",
-            "properties": {
-                "genome": {
-                    "type": "string",
-                    "description": "Name of iGenomes reference.",
-                    "fa_icon": "fas fa-book",
-                    "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
-                    "hidden": true
-                },
-                "igenomes_base": {
-                    "type": "string",
-                    "format": "directory-path",
-                    "description": "Directory / URL base for iGenomes references.",
-                    "default": "s3://ngi-igenomes/igenomes",
-                    "fa_icon": "fas fa-cloud-download-alt",
-                    "hidden": true
-                },
-                "igenomes_ignore": {
-                    "type": "boolean",
-                    "description": "Do not load the iGenomes reference config.",
-                    "fa_icon": "fas fa-ban",
-                    "hidden": true,
-                    "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
-                }
-            }
+        "multiqc_title": {
+          "type": "string",
+          "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
+          "fa_icon": "fas fa-file-signature"
         }
+      }
     },
-    "allOf": [
-        {
-            "$ref": "#/definitions/input_output_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_general_qc_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_short_read_qc_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_long_read_qc_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_host_removal_options"
-        },
-        {
-            "$ref": "#/definitions/preprocessing_run_merging_options"
-        },
-        {
-            "$ref": "#/definitions/profiling_options"
-        },
-        {
-            "$ref": "#/definitions/postprocessing_and_visualisation_options"
-        },
-        {
-            "$ref": "#/definitions/institutional_config_options"
-        },
-        {
-            "$ref": "#/definitions/max_job_request_options"
-        },
-        {
-            "$ref": "#/definitions/generic_options"
-        },
-        {
-            "$ref": "#/definitions/reference_genome_options"
+    "preprocessing_general_qc_options": {
+      "title": "Preprocessing general QC options",
+      "type": "object",
+      "description": "Common options across both long and short read preprocessing QC steps",
+      "default": "",
+      "properties": {
+        "save_preprocessed_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
+          "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
         }
-    ],
-    "properties": {
+      },
+      "fa_icon": "fas fa-users-cog"
+    },
+    "preprocessing_short_read_qc_options": {
+      "title": "Preprocessing short-read QC options",
+      "type": "object",
+      "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
+      "default": "",
+      "properties": {
+        "perform_shortread_qc": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
+          "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
+        },
+        "shortread_qc_tool": {
+          "type": "string",
+          "default": "fastp",
+          "enum": ["fastp", "adapterremoval"],
+          "fa_icon": "fas fa-tools",
+          "description": "Specify which tool to use for short-read QC"
+        },
+        "shortread_qc_skipadaptertrim": {
+          "type": "boolean",
+          "fa_icon": "fas fa-forward",
+          "description": "Skip adapter trimming",
+          "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
+        },
+        "shortread_qc_adapter1": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-grip-lines",
+          "description": "Specify adapter 1 nucleotide sequence",
+          "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
+        },
+        "shortread_qc_adapter2": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-grip-lines",
+          "description": "Specify adapter 2 nucleotide sequence",
+          "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
+        },
+        "shortread_qc_adapterlist": {
+          "type": "string",
+          "default": "None",
+          "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
+          "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
+        },
+        "shortread_qc_mergepairs": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on merging of read pairs for paired-end data",
+          "default": true,
+          "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
+        },
+        "shortread_qc_excludeunmerged": {
+          "type": "boolean",
+          "fa_icon": "far fa-times-circle",
+          "description": "Discard unmerged reads from paired-end merging",
+          "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
+        },
+        "shortread_qc_minlength": {
+          "type": "integer",
+          "default": 15,
+          "fa_icon": "fas fa-ruler-horizontal",
+          "description": "Specify the minimum length of reads to be retained",
+          "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
+        },
+        "perform_shortread_complexityfilter": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turns on nucleotide sequence complexity filtering",
+          "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
+        },
+        "shortread_complexityfilter_tool": {
+          "type": "string",
+          "default": "bbduk",
+          "enum": ["bbduk", "prinseqplusplus", "fastp"],
+          "fa_icon": "fas fa-hammer",
+          "description": "Specify which tool to use for complexity filtering"
+        },
+        "shortread_complexityfilter_entropy": {
+          "type": "number",
+          "default": 0.3,
+          "fa_icon": "fas fa-random",
+          "description": "Specify the minimum sequence entropy level for complexity filtering",
+          "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
+        },
+        "shortread_complexityfilter_bbduk_windowsize": {
+          "type": "integer",
+          "default": 50,
+          "fa_icon": "far fa-window-maximize",
+          "description": "Specify the window size for BBDuk complexity filtering",
+          "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
+        },
+        "shortread_complexityfilter_bbduk_mask": {
+          "type": "boolean",
+          "fa_icon": "fas fa-mask",
+          "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
+          "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
+        },
+        "shortread_complexityfilter_fastp_threshold": {
+          "type": "integer",
+          "default": 30,
+          "fa_icon": "fas fa-sort-numeric-down",
+          "description": "Specify the minimum complexity filter threshold of fastp",
+          "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
+        },
+        "shortread_complexityfilter_prinseqplusplus_mode": {
+          "type": "string",
+          "default": "entropy",
+          "enum": ["entropy", "dust"],
+          "fa_icon": "fas fa-check-square",
+          "description": "Specify the complexity filter mode for PRINSEQ++"
+        },
+        "shortread_complexityfilter_prinseqplusplus_dustscore": {
+          "type": "number",
+          "default": 0.5,
+          "fa_icon": "fas fa-head-side-mask",
+          "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
+          "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
+        },
+        "save_complexityfiltered_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save complexity filtered short-reads",
+          "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
+        }
+      },
+      "fa_icon": "fas fa-compress-alt"
+    },
+    "preprocessing_long_read_qc_options": {
+      "title": "Preprocessing long-read QC options",
+      "type": "object",
+      "description": "Options for adapter clipping, quality trimming, and length filtering",
+      "default": "",
+      "properties": {
+        "perform_longread_qc": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
+          "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
+        },
+        "longread_qc_skipadaptertrim": {
+          "type": "boolean",
+          "description": "Skip long-read trimming",
+          "fa_icon": "fas fa-forward",
+          "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
+        },
+        "longread_qc_skipqualityfilter": {
+          "type": "boolean",
+          "description": "Skip long-read length and quality filtering",
+          "fa_icon": "fas fa-forward",
+          "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
+        },
+        "longread_qc_qualityfilter_minlength": {
+          "type": "integer",
+          "default": 1000,
+          "description": "Specify the minimum length of reads to be retained",
+          "fa_icon": "fas fa-ruler-horizontal",
+          "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
+        },
+        "longread_qc_qualityfilter_keeppercent": {
+          "type": "integer",
+          "default": 90,
+          "description": "Specify the percent of high-quality bases to be retained",
+          "fa_icon": "fas fa-percentage",
+          "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+        },
+        "longread_qc_qualityfilter_targetbases": {
+          "type": "integer",
+          "default": 500000000,
+          "description": "Specify the number of high-quality bases in the library to be retained",
+          "fa_icon": "fas fa-bullseye",
+          "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+        }
+      },
+      "fa_icon": "fas fa-expand-alt"
+    },
+    "preprocessing_host_removal_options": {
+      "title": "Preprocessing host removal options",
+      "type": "object",
+      "description": "Options for pre-profiling host read removal",
+      "default": "",
+      "properties": {
+        "perform_shortread_hostremoval": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on short-read host removal",
+          "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+        },
+        "perform_longread_hostremoval": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on long-read host removal",
+          "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+        },
+        "hostremoval_reference": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-file-alt",
+          "description": "Specify path to single reference FASTA of host(s) genome(s)",
+          "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
+        },
+        "shortread_hostremoval_index": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-address-book",
+          "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
+          "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+        },
+        "longread_hostremoval_index": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-address-book",
+          "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
+          "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+        },
+        "save_hostremoval_index": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save mapping index of input reference when not already supplied by user",
+          "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
+        },
+        "save_hostremoval_mapped": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save mapped reads in BAM format from host removal",
+          "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
+        },
+        "save_hostremoval_unmapped": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save unmapped reads in FASTQ format from host removal",
+          "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
+        }
+      },
+      "fa_icon": "fas fa-user-times"
+    },
+    "preprocessing_run_merging_options": {
+      "title": "Preprocessing run merging options",
+      "type": "object",
+      "description": "Options for per-sample run-merging",
+      "default": "",
+      "properties": {
+        "perform_runmerging": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on run merging",
+          "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
+        },
+        "save_runmerged_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Save run-concatenated input FASTQ files for each sample",
+          "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
+        }
+      },
+      "fa_icon": "fas fa-clipboard-check"
+    },
+    "profiling_options": {
+      "title": "Profiling options",
+      "type": "object",
+      "description": "",
+      "default": "",
+      "properties": {
+        "run_centrifuge": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
+        },
+        "centrifuge_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of Centrifuge-aligned reads",
+          "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
+        },
+        "run_diamond": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
+        },
+        "diamond_output_format": {
+          "type": "string",
+          "default": "tsv",
+          "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
+          "fa_icon": "fas fa-file",
+          "description": "Specify output format from DIAMOND profiling.",
+          "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
+        },
+        "diamond_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
+          "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
+        },
+        "run_kaiju": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
+        },
+        "kaiju_taxon_rank": {
+          "type": "string",
+          "default": "species",
+          "enum": ["phylum", "class", "order", "family", "genus", "species"],
+          "fa_icon": "fas fa-tag",
+          "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
+          "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
+        },
+        "run_kraken2": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
+        },
+        "kraken2_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of Kraken2-aligned reads",
+          "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
+        },
+        "kraken2_save_readclassification": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
+          "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
+        },
+        "kraken2_save_minimizers": {
+          "type": "boolean",
+          "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
+          "fa_icon": "fas fa-save",
+          "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
+        },
+        "run_bracken": {
+          "type": "boolean",
+          "description": "Post-process kraken2 reports with Bracken.",
+          "fa_icon": "fas fa-toggle-on"
+        },
+        "run_malt": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
+        },
+        "malt_mode": {
+          "type": "string",
+          "default": "BlastN",
+          "fa_icon": "fas fa-check-square",
+          "description": "Specify which MALT alignment mode to use",
+          "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
+        },
+        "malt_save_reads": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on saving of MALT-aligned reads",
+          "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
+        },
+        "malt_generate_megansummary": {
+          "type": "boolean",
+          "fa_icon": "fas fa-save",
+          "description": "Turn on generation of MEGAN summary file from MALT results",
+          "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
+        },
+        "run_metaphlan3": {
+          "type": "boolean",
+          "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
+          "fa_icon": "fas fa-toggle-on"
+        },
+        "run_motus": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
+        }
+      },
+      "fa_icon": "fas fa-align-center"
+    },
+    "postprocessing_and_visualisation_options": {
+      "title": "Postprocessing and visualisation options",
+      "type": "object",
+      "description": "",
+      "default": "",
+      "properties": {
+        "run_profile_standardisation": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on standardisation of taxon tables across profilers",
+          "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
+        },
+        "generate_biom_output": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
+          "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
+        },
+        "run_krona": {
+          "type": "boolean",
+          "fa_icon": "fas fa-toggle-on",
+          "description": "Turn on generation of Krona plots for supported profilers",
+          "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
+        },
+        "krona_taxonomy_directory": {
+          "type": "string",
+          "default": "None",
+          "fa_icon": "fas fa-folder-open",
+          "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
+          "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
+        }
+      },
+      "fa_icon": "fas fa-chart-line"
+    },
+    "institutional_config_options": {
+      "title": "Institutional config options",
+      "type": "object",
+      "fa_icon": "fas fa-university",
+      "description": "Parameters used to describe centralised config profiles. These should not be edited.",
+      "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
+      "properties": {
+        "custom_config_version": {
+          "type": "string",
+          "description": "Git commit id for Institutional configs.",
+          "default": "master",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "custom_config_base": {
+          "type": "string",
+          "description": "Base directory for Institutional configs.",
+          "default": "https://raw.githubusercontent.com/nf-core/configs/master",
+          "hidden": true,
+          "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_name": {
+          "type": "string",
+          "description": "Institutional config name.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_description": {
+          "type": "string",
+          "description": "Institutional config description.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_contact": {
+          "type": "string",
+          "description": "Institutional config contact information.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        },
+        "config_profile_url": {
+          "type": "string",
+          "description": "Institutional config URL link.",
+          "hidden": true,
+          "fa_icon": "fas fa-users-cog"
+        }
+      }
+    },
+    "max_job_request_options": {
+      "title": "Max job request options",
+      "type": "object",
+      "fa_icon": "fab fa-acquisitions-incorporated",
+      "description": "Set the top limit for requested resources for any single job.",
+      "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
+      "properties": {
+        "max_cpus": {
+          "type": "integer",
+          "description": "Maximum number of CPUs that can be requested for any single job.",
+          "default": 16,
+          "fa_icon": "fas fa-microchip",
+          "hidden": true,
+          "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
+        },
+        "max_memory": {
+          "type": "string",
+          "description": "Maximum amount of memory that can be requested for any single job.",
+          "default": "128.GB",
+          "fa_icon": "fas fa-memory",
+          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+          "hidden": true,
+          "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
+        },
+        "max_time": {
+          "type": "string",
+          "description": "Maximum amount of time that can be requested for any single job.",
+          "default": "240.h",
+          "fa_icon": "far fa-clock",
+          "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
+          "hidden": true,
+          "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
+        }
+      }
+    },
+    "generic_options": {
+      "title": "Generic options",
+      "type": "object",
+      "fa_icon": "fas fa-file-import",
+      "description": "Less common options for the pipeline, typically set in a config file.",
+      "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
+      "properties": {
+        "help": {
+          "type": "boolean",
+          "description": "Display help text.",
+          "fa_icon": "fas fa-question-circle",
+          "hidden": true
+        },
+        "publish_dir_mode": {
+          "type": "string",
+          "default": "copy",
+          "description": "Method used to save pipeline results to output directory.",
+          "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
+          "fa_icon": "fas fa-copy",
+          "enum": [
+            "symlink",
+            "rellink",
+            "link",
+            "copy",
+            "copyNoFollow",
+            "move"
+          ],
+          "hidden": true
+        },
+        "email_on_fail": {
+          "type": "string",
+          "description": "Email address for completion summary, only when pipeline fails.",
+          "fa_icon": "fas fa-exclamation-triangle",
+          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
+          "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
+          "hidden": true
+        },
+        "plaintext_email": {
+          "type": "boolean",
+          "description": "Send plain-text email instead of HTML.",
+          "fa_icon": "fas fa-remove-format",
+          "hidden": true
+        },
+        "max_multiqc_email_size": {
+          "type": "string",
+          "description": "File size limit when attaching MultiQC reports to summary emails.",
+          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+          "default": "25.MB",
+          "fa_icon": "fas fa-file-upload",
+          "hidden": true
+        },
         "preprocessing_qc_tool": {
-            "type": "string",
-            "default": "fastqc",
-            "enum": ["fastqc", "falco"],
-            "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
-            "description": "Specify the tool used for quality control of raw sequencing reads"
+          "type": "string",
+          "default": "fastqc",
+          "enum": ["fastqc", "falco"],
+          "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
+          "description": "Specify the tool used for quality control of raw sequencing reads"
         },
-        "save_mgc_counts": {
-            "type": "boolean",
-            "description": "Save the mgc reads count for mOTUs."
+        "monochrome_logs": {
+          "type": "boolean",
+          "description": "Do not use coloured log outputs.",
+          "fa_icon": "fas fa-palette",
+          "hidden": true
         },
-        "save_ncbi_id": {
-            "type": "boolean",
-            "description": "Print NCBI taxonomic id for mOTUs."
+        "hook_url": {
+          "type": "string",
+          "description": "Incoming hook URL for messaging service",
+          "fa_icon": "fas fa-people-group",
+          "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
+          "hidden": true
         },
-        "save_read_counts": {
-            "type": "boolean",
-            "description": "Print mOTUs result as counts instead of relative abundances."
+        "multiqc_config": {
+          "type": "string",
+          "description": "Custom config file to supply to MultiQC.",
+          "fa_icon": "fas fa-cog",
+          "hidden": true
+        },
+        "multiqc_logo": {
+          "type": "string",
+          "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
+          "fa_icon": "fas fa-image",
+          "hidden": true
+        },
+        "multiqc_methods_description": {
+          "type": "string",
+          "description": "Custom MultiQC yaml file containing HTML including a methods description.",
+          "fa_icon": "fas fa-cog"
+        },
+        "tracedir": {
+          "type": "string",
+          "description": "Directory to keep pipeline Nextflow logs and reports.",
+          "default": "${params.outdir}/pipeline_info",
+          "fa_icon": "fas fa-cogs",
+          "hidden": true
+        },
+        "validate_params": {
+          "type": "boolean",
+          "description": "Boolean whether to validate parameters against the schema at runtime",
+          "default": true,
+          "fa_icon": "fas fa-check-square",
+          "hidden": true
+        },
+        "show_hidden_params": {
+          "type": "boolean",
+          "fa_icon": "far fa-eye-slash",
+          "description": "Show all params when using `--help`",
+          "hidden": true,
+          "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
+        },
+        "enable_conda": {
+          "type": "boolean",
+          "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
+          "hidden": true,
+          "fa_icon": "fas fa-bacon"
         }
+      }
+    },
+    "reference_genome_options": {
+      "title": "Reference genome options",
+      "type": "object",
+      "fa_icon": "fas fa-dna",
+      "description": "Reference genome related files and options required for the workflow.",
+      "properties": {
+        "genome": {
+          "type": "string",
+          "description": "Name of iGenomes reference.",
+          "fa_icon": "fas fa-book",
+          "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
+          "hidden": true
+        },
+        "igenomes_base": {
+          "type": "string",
+          "format": "directory-path",
+          "description": "Directory / URL base for iGenomes references.",
+          "default": "s3://ngi-igenomes/igenomes",
+          "fa_icon": "fas fa-cloud-download-alt",
+          "hidden": true
+        },
+        "igenomes_ignore": {
+          "type": "boolean",
+          "description": "Do not load the iGenomes reference config.",
+          "fa_icon": "fas fa-ban",
+          "hidden": true,
+          "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
+        }
+      }
     }
+  },
+  "allOf": [
+    {
+      "$ref": "#/definitions/input_output_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_general_qc_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_short_read_qc_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_long_read_qc_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_host_removal_options"
+    },
+    {
+      "$ref": "#/definitions/preprocessing_run_merging_options"
+    },
+    {
+      "$ref": "#/definitions/profiling_options"
+    },
+    {
+      "$ref": "#/definitions/postprocessing_and_visualisation_options"
+    },
+    {
+      "$ref": "#/definitions/institutional_config_options"
+    },
+    {
+      "$ref": "#/definitions/max_job_request_options"
+    },
+    {
+      "$ref": "#/definitions/generic_options"
+    },
+    {
+      "$ref": "#/definitions/reference_genome_options"
+    }
+  ],
+  "properties": {
+    "save_mgc_counts": {
+      "type": "boolean",
+      "description": "Save the mgc reads count for mOTUs."
+    },
+    "save_ncbi_id": {
+      "type": "boolean",
+      "description": "Print NCBI taxonomic id for mOTUs."
+    },
+    "save_read_counts": {
+      "type": "boolean",
+      "description": "Print mOTUs result as counts instead of relative abundances."
+    }
+  }
 }

From 12dd836e9c3f99d1028d43d6745ae66f48b6a2f4 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 15:00:27 +0100
Subject: [PATCH 17/25] Fix conflict

---
 nextflow_schema.json | 1526 +++++++++++++++++++++---------------------
 1 file changed, 778 insertions(+), 748 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index df4b4e7..0ec5d48 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -1,756 +1,786 @@
 {
-  "$schema": "http://json-schema.org/draft-07/schema",
-  "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
-  "title": "nf-core/taxprofiler pipeline parameters",
-  "description": "Taxonomic profiling of shotgun metagenomic data",
-  "type": "object",
-  "definitions": {
-    "input_output_options": {
-      "title": "Input/output options",
-      "type": "object",
-      "fa_icon": "fas fa-terminal",
-      "description": "Define where the pipeline should find input data and save output data.",
-      "required": ["input", "databases", "outdir"],
-      "properties": {
-        "input": {
-          "type": "string",
-          "format": "file-path",
-          "mimetype": "text/csv",
-          "pattern": "^\\S+\\.(csv|yaml|yml)$",
-          "schema": "assets/schema_input.json",
-          "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
-          "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
-          "fa_icon": "fas fa-file-csv"
+    "$schema": "http://json-schema.org/draft-07/schema",
+    "$id": "https://raw.githubusercontent.com/nf-core/taxprofiler/master/nextflow_schema.json",
+    "title": "nf-core/taxprofiler pipeline parameters",
+    "description": "Taxonomic profiling of shotgun metagenomic data",
+    "type": "object",
+    "definitions": {
+        "input_output_options": {
+            "title": "Input/output options",
+            "type": "object",
+            "fa_icon": "fas fa-terminal",
+            "description": "Define where the pipeline should find input data and save output data.",
+            "required": [
+                "input",
+                "databases",
+                "outdir"
+            ],
+            "properties": {
+                "input": {
+                    "type": "string",
+                    "format": "file-path",
+                    "mimetype": "text/csv",
+                    "pattern": "^\\S+\\.(csv|yaml|yml)$",
+                    "schema": "assets/schema_input.json",
+                    "description": "Path to comma-separated file containing information about the samples and libraries/runs.",
+                    "help_text": "You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
+                    "fa_icon": "fas fa-file-csv"
+                },
+                "databases": {
+                    "type": "string",
+                    "mimetype": "text/csv",
+                    "format": "file-path",
+                    "fa_icon": "fas fa-database",
+                    "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
+                    "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
+                },
+                "outdir": {
+                    "type": "string",
+                    "format": "directory-path",
+                    "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
+                    "fa_icon": "fas fa-folder-open"
+                },
+                "email": {
+                    "type": "string",
+                    "description": "Email address for completion summary.",
+                    "fa_icon": "fas fa-envelope",
+                    "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
+                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
+                },
+                "multiqc_title": {
+                    "type": "string",
+                    "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
+                    "fa_icon": "fas fa-file-signature"
+                }
+            }
         },
-        "databases": {
-          "type": "string",
-          "mimetype": "text/csv",
-          "format": "file-path",
-          "fa_icon": "fas fa-database",
-          "description": "Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
-          "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding  database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
+        "preprocessing_general_qc_options": {
+            "title": "Preprocessing general QC options",
+            "type": "object",
+            "description": "Common options across both long and short read preprocessing QC steps",
+            "default": "",
+            "properties": {
+                "save_preprocessed_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
+                    "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
+                }
+            },
+            "fa_icon": "fas fa-users-cog"
         },
-        "outdir": {
-          "type": "string",
-          "format": "directory-path",
-          "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
-          "fa_icon": "fas fa-folder-open"
+        "preprocessing_short_read_qc_options": {
+            "title": "Preprocessing short-read QC options",
+            "type": "object",
+            "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
+            "default": "",
+            "properties": {
+                "perform_shortread_qc": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
+                    "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
+                },
+                "shortread_qc_tool": {
+                    "type": "string",
+                    "default": "fastp",
+                    "enum": [
+                        "fastp",
+                        "adapterremoval"
+                    ],
+                    "fa_icon": "fas fa-tools",
+                    "description": "Specify which tool to use for short-read QC"
+                },
+                "shortread_qc_skipadaptertrim": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-forward",
+                    "description": "Skip adapter trimming",
+                    "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
+                },
+                "shortread_qc_adapter1": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-grip-lines",
+                    "description": "Specify adapter 1 nucleotide sequence",
+                    "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
+                },
+                "shortread_qc_adapter2": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-grip-lines",
+                    "description": "Specify adapter 2 nucleotide sequence",
+                    "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
+                },
+                "shortread_qc_adapterlist": {
+                    "type": "string",
+                    "default": "None",
+                    "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
+                    "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
+                },
+                "shortread_qc_mergepairs": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on merging of read pairs for paired-end data",
+                    "default": true,
+                    "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
+                },
+                "shortread_qc_excludeunmerged": {
+                    "type": "boolean",
+                    "fa_icon": "far fa-times-circle",
+                    "description": "Discard unmerged reads from paired-end merging",
+                    "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
+                },
+                "shortread_qc_minlength": {
+                    "type": "integer",
+                    "default": 15,
+                    "fa_icon": "fas fa-ruler-horizontal",
+                    "description": "Specify the minimum length of reads to be retained",
+                    "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
+                },
+                "perform_shortread_complexityfilter": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turns on nucleotide sequence complexity filtering",
+                    "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
+                },
+                "shortread_complexityfilter_tool": {
+                    "type": "string",
+                    "default": "bbduk",
+                    "enum": [
+                        "bbduk",
+                        "prinseqplusplus",
+                        "fastp"
+                    ],
+                    "fa_icon": "fas fa-hammer",
+                    "description": "Specify which tool to use for complexity filtering"
+                },
+                "shortread_complexityfilter_entropy": {
+                    "type": "number",
+                    "default": 0.3,
+                    "fa_icon": "fas fa-random",
+                    "description": "Specify the minimum sequence entropy level for complexity filtering",
+                    "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
+                },
+                "shortread_complexityfilter_bbduk_windowsize": {
+                    "type": "integer",
+                    "default": 50,
+                    "fa_icon": "far fa-window-maximize",
+                    "description": "Specify the window size for BBDuk complexity filtering",
+                    "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
+                },
+                "shortread_complexityfilter_bbduk_mask": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-mask",
+                    "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
+                    "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
+                },
+                "shortread_complexityfilter_fastp_threshold": {
+                    "type": "integer",
+                    "default": 30,
+                    "fa_icon": "fas fa-sort-numeric-down",
+                    "description": "Specify the minimum complexity filter threshold of fastp",
+                    "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
+                },
+                "shortread_complexityfilter_prinseqplusplus_mode": {
+                    "type": "string",
+                    "default": "entropy",
+                    "enum": [
+                        "entropy",
+                        "dust"
+                    ],
+                    "fa_icon": "fas fa-check-square",
+                    "description": "Specify the complexity filter mode for PRINSEQ++"
+                },
+                "shortread_complexityfilter_prinseqplusplus_dustscore": {
+                    "type": "number",
+                    "default": 0.5,
+                    "fa_icon": "fas fa-head-side-mask",
+                    "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
+                    "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
+                },
+                "save_complexityfiltered_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save complexity filtered short-reads",
+                    "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
+                }
+            },
+            "fa_icon": "fas fa-compress-alt"
         },
-        "email": {
-          "type": "string",
-          "description": "Email address for completion summary.",
-          "fa_icon": "fas fa-envelope",
-          "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
-          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
+        "preprocessing_long_read_qc_options": {
+            "title": "Preprocessing long-read QC options",
+            "type": "object",
+            "description": "Options for adapter clipping, quality trimming, and length filtering",
+            "default": "",
+            "properties": {
+                "perform_longread_qc": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
+                    "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
+                },
+                "longread_qc_skipadaptertrim": {
+                    "type": "boolean",
+                    "description": "Skip long-read trimming",
+                    "fa_icon": "fas fa-forward",
+                    "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
+                },
+                "longread_qc_skipqualityfilter": {
+                    "type": "boolean",
+                    "description": "Skip long-read length and quality filtering",
+                    "fa_icon": "fas fa-forward",
+                    "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
+                },
+                "longread_qc_qualityfilter_minlength": {
+                    "type": "integer",
+                    "default": 1000,
+                    "description": "Specify the minimum length of reads to be retained",
+                    "fa_icon": "fas fa-ruler-horizontal",
+                    "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
+                },
+                "longread_qc_qualityfilter_keeppercent": {
+                    "type": "integer",
+                    "default": 90,
+                    "description": "Specify the percent of high-quality bases to be retained",
+                    "fa_icon": "fas fa-percentage",
+                    "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+                },
+                "longread_qc_qualityfilter_targetbases": {
+                    "type": "integer",
+                    "default": 500000000,
+                    "description": "Specify the number of high-quality bases in the library to be retained",
+                    "fa_icon": "fas fa-bullseye",
+                    "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
+                }
+            },
+            "fa_icon": "fas fa-expand-alt"
         },
-        "multiqc_title": {
-          "type": "string",
-          "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
-          "fa_icon": "fas fa-file-signature"
+        "preprocessing_host_removal_options": {
+            "title": "Preprocessing host removal options",
+            "type": "object",
+            "description": "Options for pre-profiling host read removal",
+            "default": "",
+            "properties": {
+                "perform_shortread_hostremoval": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on short-read host removal",
+                    "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+                },
+                "perform_longread_hostremoval": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on long-read host removal",
+                    "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
+                },
+                "hostremoval_reference": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-file-alt",
+                    "description": "Specify path to single reference FASTA of host(s) genome(s)",
+                    "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
+                },
+                "shortread_hostremoval_index": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-address-book",
+                    "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
+                    "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+                },
+                "longread_hostremoval_index": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-address-book",
+                    "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
+                    "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
+                },
+                "save_hostremoval_index": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save mapping index of input reference when not already supplied by user",
+                    "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
+                },
+                "save_hostremoval_mapped": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save mapped reads in BAM format from host removal",
+                    "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
+                },
+                "save_hostremoval_unmapped": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save unmapped reads in FASTQ format from host removal",
+                    "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
+                }
+            },
+            "fa_icon": "fas fa-user-times"
+        },
+        "preprocessing_run_merging_options": {
+            "title": "Preprocessing run merging options",
+            "type": "object",
+            "description": "Options for per-sample run-merging",
+            "default": "",
+            "properties": {
+                "perform_runmerging": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on run merging",
+                    "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
+                },
+                "save_runmerged_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Save run-concatenated input FASTQ files for each sample",
+                    "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
+                }
+            },
+            "fa_icon": "fas fa-clipboard-check"
+        },
+        "profiling_options": {
+            "title": "Profiling options",
+            "type": "object",
+            "description": "",
+            "default": "",
+            "properties": {
+                "run_centrifuge": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
+                },
+                "centrifuge_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of Centrifuge-aligned reads",
+                    "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
+                },
+                "run_diamond": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
+                },
+                "diamond_output_format": {
+                    "type": "string",
+                    "default": "tsv",
+                    "enum": [
+                        "blast",
+                        "xml",
+                        "txt",
+                        "daa",
+                        "sam",
+                        "tsv",
+                        "paf"
+                    ],
+                    "fa_icon": "fas fa-file",
+                    "description": "Specify output format from DIAMOND profiling.",
+                    "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
+                },
+                "diamond_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
+                    "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
+                },
+                "run_kaiju": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
+                },
+                "kaiju_taxon_rank": {
+                    "type": "string",
+                    "default": "species",
+                    "enum": [
+                        "phylum",
+                        "class",
+                        "order",
+                        "family",
+                        "genus",
+                        "species"
+                    ],
+                    "fa_icon": "fas fa-tag",
+                    "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
+                    "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
+                },
+                "run_kraken2": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
+                },
+                "kraken2_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of Kraken2-aligned reads",
+                    "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
+                },
+                "kraken2_save_readclassification": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
+                    "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
+                },
+                "kraken2_save_minimizers": {
+                    "type": "boolean",
+                    "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
+                    "fa_icon": "fas fa-save",
+                    "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
+                },
+                "run_bracken": {
+                    "type": "boolean",
+                    "description": "Post-process kraken2 reports with Bracken.",
+                    "fa_icon": "fas fa-toggle-on"
+                },
+                "run_malt": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
+                },
+                "malt_mode": {
+                    "type": "string",
+                    "default": "BlastN",
+                    "fa_icon": "fas fa-check-square",
+                    "description": "Specify which MALT alignment mode to use",
+                    "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
+                },
+                "malt_save_reads": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on saving of MALT-aligned reads",
+                    "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
+                },
+                "malt_generate_megansummary": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-save",
+                    "description": "Turn on generation of MEGAN summary file from MALT results",
+                    "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
+                },
+                "run_metaphlan3": {
+                    "type": "boolean",
+                    "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
+                    "fa_icon": "fas fa-toggle-on"
+                },
+                "run_motus": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
+                },
+                "save_mgc_counts": {
+                    "type": "boolean",
+                    "description": "Save the mgc reads count for mOTUs."
+                },
+                "save_read_counts": {
+                    "type": "boolean",
+                    "description": "Print mOTUs result as counts instead of relative abundances."
+                },
+                "save_ncbi_id": {
+                    "type": "boolean",
+                    "description": "Print NCBI taxonomic id for mOTUs."
+                }
+            },
+            "fa_icon": "fas fa-align-center"
+        },
+        "postprocessing_and_visualisation_options": {
+            "title": "Postprocessing and visualisation options",
+            "type": "object",
+            "description": "",
+            "default": "",
+            "properties": {
+                "run_profile_standardisation": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on standardisation of taxon tables across profilers",
+                    "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
+                },
+                "generate_biom_output": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
+                    "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
+                },
+                "run_krona": {
+                    "type": "boolean",
+                    "fa_icon": "fas fa-toggle-on",
+                    "description": "Turn on generation of Krona plots for supported profilers",
+                    "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
+                },
+                "krona_taxonomy_directory": {
+                    "type": "string",
+                    "default": "None",
+                    "fa_icon": "fas fa-folder-open",
+                    "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
+                    "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
+                }
+            },
+            "fa_icon": "fas fa-chart-line"
+        },
+        "institutional_config_options": {
+            "title": "Institutional config options",
+            "type": "object",
+            "fa_icon": "fas fa-university",
+            "description": "Parameters used to describe centralised config profiles. These should not be edited.",
+            "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
+            "properties": {
+                "custom_config_version": {
+                    "type": "string",
+                    "description": "Git commit id for Institutional configs.",
+                    "default": "master",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "custom_config_base": {
+                    "type": "string",
+                    "description": "Base directory for Institutional configs.",
+                    "default": "https://raw.githubusercontent.com/nf-core/configs/master",
+                    "hidden": true,
+                    "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_name": {
+                    "type": "string",
+                    "description": "Institutional config name.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_description": {
+                    "type": "string",
+                    "description": "Institutional config description.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_contact": {
+                    "type": "string",
+                    "description": "Institutional config contact information.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                },
+                "config_profile_url": {
+                    "type": "string",
+                    "description": "Institutional config URL link.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-users-cog"
+                }
+            }
+        },
+        "max_job_request_options": {
+            "title": "Max job request options",
+            "type": "object",
+            "fa_icon": "fab fa-acquisitions-incorporated",
+            "description": "Set the top limit for requested resources for any single job.",
+            "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
+            "properties": {
+                "max_cpus": {
+                    "type": "integer",
+                    "description": "Maximum number of CPUs that can be requested for any single job.",
+                    "default": 16,
+                    "fa_icon": "fas fa-microchip",
+                    "hidden": true,
+                    "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
+                },
+                "max_memory": {
+                    "type": "string",
+                    "description": "Maximum amount of memory that can be requested for any single job.",
+                    "default": "128.GB",
+                    "fa_icon": "fas fa-memory",
+                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+                    "hidden": true,
+                    "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
+                },
+                "max_time": {
+                    "type": "string",
+                    "description": "Maximum amount of time that can be requested for any single job.",
+                    "default": "240.h",
+                    "fa_icon": "far fa-clock",
+                    "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
+                    "hidden": true,
+                    "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
+                }
+            }
+        },
+        "generic_options": {
+            "title": "Generic options",
+            "type": "object",
+            "fa_icon": "fas fa-file-import",
+            "description": "Less common options for the pipeline, typically set in a config file.",
+            "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
+            "properties": {
+                "help": {
+                    "type": "boolean",
+                    "description": "Display help text.",
+                    "fa_icon": "fas fa-question-circle",
+                    "hidden": true
+                },
+                "publish_dir_mode": {
+                    "type": "string",
+                    "default": "copy",
+                    "description": "Method used to save pipeline results to output directory.",
+                    "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
+                    "fa_icon": "fas fa-copy",
+                    "enum": [
+                        "symlink",
+                        "rellink",
+                        "link",
+                        "copy",
+                        "copyNoFollow",
+                        "move"
+                    ],
+                    "hidden": true
+                },
+                "email_on_fail": {
+                    "type": "string",
+                    "description": "Email address for completion summary, only when pipeline fails.",
+                    "fa_icon": "fas fa-exclamation-triangle",
+                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
+                    "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
+                    "hidden": true
+                },
+                "plaintext_email": {
+                    "type": "boolean",
+                    "description": "Send plain-text email instead of HTML.",
+                    "fa_icon": "fas fa-remove-format",
+                    "hidden": true
+                },
+                "max_multiqc_email_size": {
+                    "type": "string",
+                    "description": "File size limit when attaching MultiQC reports to summary emails.",
+                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
+                    "default": "25.MB",
+                    "fa_icon": "fas fa-file-upload",
+                    "hidden": true
+                },
+                "preprocessing_qc_tool": {
+                    "type": "string",
+                    "default": "fastqc",
+                    "enum": [
+                        "fastqc",
+                        "falco"
+                    ],
+                    "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
+                    "description": "Specify the tool used for quality control of raw sequencing reads"
+                },
+                "monochrome_logs": {
+                    "type": "boolean",
+                    "description": "Do not use coloured log outputs.",
+                    "fa_icon": "fas fa-palette",
+                    "hidden": true
+                },
+                "hook_url": {
+                    "type": "string",
+                    "description": "Incoming hook URL for messaging service",
+                    "fa_icon": "fas fa-people-group",
+                    "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
+                    "hidden": true
+                },
+                "multiqc_config": {
+                    "type": "string",
+                    "description": "Custom config file to supply to MultiQC.",
+                    "fa_icon": "fas fa-cog",
+                    "hidden": true
+                },
+                "multiqc_logo": {
+                    "type": "string",
+                    "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
+                    "fa_icon": "fas fa-image",
+                    "hidden": true
+                },
+                "multiqc_methods_description": {
+                    "type": "string",
+                    "description": "Custom MultiQC yaml file containing HTML including a methods description.",
+                    "fa_icon": "fas fa-cog"
+                },
+                "tracedir": {
+                    "type": "string",
+                    "description": "Directory to keep pipeline Nextflow logs and reports.",
+                    "default": "${params.outdir}/pipeline_info",
+                    "fa_icon": "fas fa-cogs",
+                    "hidden": true
+                },
+                "validate_params": {
+                    "type": "boolean",
+                    "description": "Boolean whether to validate parameters against the schema at runtime",
+                    "default": true,
+                    "fa_icon": "fas fa-check-square",
+                    "hidden": true
+                },
+                "show_hidden_params": {
+                    "type": "boolean",
+                    "fa_icon": "far fa-eye-slash",
+                    "description": "Show all params when using `--help`",
+                    "hidden": true,
+                    "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
+                },
+                "enable_conda": {
+                    "type": "boolean",
+                    "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
+                    "hidden": true,
+                    "fa_icon": "fas fa-bacon"
+                }
+            }
+        },
+        "reference_genome_options": {
+            "title": "Reference genome options",
+            "type": "object",
+            "fa_icon": "fas fa-dna",
+            "description": "Reference genome related files and options required for the workflow.",
+            "properties": {
+                "genome": {
+                    "type": "string",
+                    "description": "Name of iGenomes reference.",
+                    "fa_icon": "fas fa-book",
+                    "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
+                    "hidden": true
+                },
+                "igenomes_base": {
+                    "type": "string",
+                    "format": "directory-path",
+                    "description": "Directory / URL base for iGenomes references.",
+                    "default": "s3://ngi-igenomes/igenomes",
+                    "fa_icon": "fas fa-cloud-download-alt",
+                    "hidden": true
+                },
+                "igenomes_ignore": {
+                    "type": "boolean",
+                    "description": "Do not load the iGenomes reference config.",
+                    "fa_icon": "fas fa-ban",
+                    "hidden": true,
+                    "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
+                }
+            }
         }
-      }
     },
-    "preprocessing_general_qc_options": {
-      "title": "Preprocessing general QC options",
-      "type": "object",
-      "description": "Common options across both long and short read preprocessing QC steps",
-      "default": "",
-      "properties": {
-        "save_preprocessed_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save reads from adapter clipping/pair-merging, length filtering for both short and long reads",
-          "help_text": "This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
+    "allOf": [
+        {
+            "$ref": "#/definitions/input_output_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_general_qc_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_short_read_qc_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_long_read_qc_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_host_removal_options"
+        },
+        {
+            "$ref": "#/definitions/preprocessing_run_merging_options"
+        },
+        {
+            "$ref": "#/definitions/profiling_options"
+        },
+        {
+            "$ref": "#/definitions/postprocessing_and_visualisation_options"
+        },
+        {
+            "$ref": "#/definitions/institutional_config_options"
+        },
+        {
+            "$ref": "#/definitions/max_job_request_options"
+        },
+        {
+            "$ref": "#/definitions/generic_options"
+        },
+        {
+            "$ref": "#/definitions/reference_genome_options"
         }
-      },
-      "fa_icon": "fas fa-users-cog"
-    },
-    "preprocessing_short_read_qc_options": {
-      "title": "Preprocessing short-read QC options",
-      "type": "object",
-      "description": "Options for adapter clipping, quality trimming, pair-merging, and complexity filtering",
-      "default": "",
-      "properties": {
-        "perform_shortread_qc": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)",
-          "help_text": "Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
-        },
-        "shortread_qc_tool": {
-          "type": "string",
-          "default": "fastp",
-          "enum": ["fastp", "adapterremoval"],
-          "fa_icon": "fas fa-tools",
-          "description": "Specify which tool to use for short-read QC"
-        },
-        "shortread_qc_skipadaptertrim": {
-          "type": "boolean",
-          "fa_icon": "fas fa-forward",
-          "description": "Skip adapter trimming",
-          "help_text": "Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
-        },
-        "shortread_qc_adapter1": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-grip-lines",
-          "description": "Specify adapter 1 nucleotide sequence",
-          "help_text": "Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
-        },
-        "shortread_qc_adapter2": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-grip-lines",
-          "description": "Specify adapter 2 nucleotide sequence",
-          "help_text": "Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
-        },
-        "shortread_qc_adapterlist": {
-          "type": "string",
-          "default": "None",
-          "description": "Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
-          "help_text": "Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
-        },
-        "shortread_qc_mergepairs": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on merging of read pairs for paired-end data",
-          "default": true,
-          "help_text": "Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
-        },
-        "shortread_qc_excludeunmerged": {
-          "type": "boolean",
-          "fa_icon": "far fa-times-circle",
-          "description": "Discard unmerged reads from paired-end merging",
-          "help_text": "Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
-        },
-        "shortread_qc_minlength": {
-          "type": "integer",
-          "default": 15,
-          "fa_icon": "fas fa-ruler-horizontal",
-          "description": "Specify the minimum length of reads to be retained",
-          "help_text": "Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
-        },
-        "perform_shortread_complexityfilter": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turns on nucleotide sequence complexity filtering",
-          "help_text": "Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
-        },
-        "shortread_complexityfilter_tool": {
-          "type": "string",
-          "default": "bbduk",
-          "enum": ["bbduk", "prinseqplusplus", "fastp"],
-          "fa_icon": "fas fa-hammer",
-          "description": "Specify which tool to use for complexity filtering"
-        },
-        "shortread_complexityfilter_entropy": {
-          "type": "number",
-          "default": 0.3,
-          "fa_icon": "fas fa-random",
-          "description": "Specify the minimum sequence entropy level for complexity filtering",
-          "help_text": "Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++:  `-lc_entropy`\n\n"
-        },
-        "shortread_complexityfilter_bbduk_windowsize": {
-          "type": "integer",
-          "default": 50,
-          "fa_icon": "far fa-window-maximize",
-          "description": "Specify the window size for BBDuk complexity filtering",
-          "help_text": "Specify the window size to calculate the level entropy within for BBDuk.\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropywindow=`"
-        },
-        "shortread_complexityfilter_bbduk_mask": {
-          "type": "boolean",
-          "fa_icon": "fas fa-mask",
-          "description": "Turn on masking rather than discarding of low complexity reads for BBduk",
-          "help_text": "Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
-        },
-        "shortread_complexityfilter_fastp_threshold": {
-          "type": "integer",
-          "default": 30,
-          "fa_icon": "fas fa-sort-numeric-down",
-          "description": "Specify the minimum complexity filter threshold of fastp",
-          "help_text": "Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
-        },
-        "shortread_complexityfilter_prinseqplusplus_mode": {
-          "type": "string",
-          "default": "entropy",
-          "enum": ["entropy", "dust"],
-          "fa_icon": "fas fa-check-square",
-          "description": "Specify the complexity filter mode for PRINSEQ++"
-        },
-        "shortread_complexityfilter_prinseqplusplus_dustscore": {
-          "type": "number",
-          "default": 0.5,
-          "fa_icon": "fas fa-head-side-mask",
-          "description": "Specify the minimum dust score for PRINTSEQ++ complexity filtering",
-          "help_text": "Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
-        },
-        "save_complexityfiltered_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save complexity filtered short-reads",
-          "help_text": "Specify whether to save the final complexity filtered reads in your results directory (`--outdir`)."
-        }
-      },
-      "fa_icon": "fas fa-compress-alt"
-    },
-    "preprocessing_long_read_qc_options": {
-      "title": "Preprocessing long-read QC options",
-      "type": "object",
-      "description": "Options for adapter clipping, quality trimming, and length filtering",
-      "default": "",
-      "properties": {
-        "perform_longread_qc": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turns on long read quality control steps (adapter clipping, length filtering etc.)",
-          "help_text": "Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
-        },
-        "longread_qc_skipadaptertrim": {
-          "type": "boolean",
-          "description": "Skip long-read trimming",
-          "fa_icon": "fas fa-forward",
-          "help_text": "Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
-        },
-        "longread_qc_skipqualityfilter": {
-          "type": "boolean",
-          "description": "Skip long-read length and quality filtering",
-          "fa_icon": "fas fa-forward",
-          "help_text": "Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
-        },
-        "longread_qc_qualityfilter_minlength": {
-          "type": "integer",
-          "default": 1000,
-          "description": "Specify the minimum length of reads to be retained",
-          "fa_icon": "fas fa-ruler-horizontal",
-          "help_text": "Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
-        },
-        "longread_qc_qualityfilter_keeppercent": {
-          "type": "integer",
-          "default": 90,
-          "description": "Specify the percent of high-quality bases to be retained",
-          "fa_icon": "fas fa-percentage",
-          "help_text": "Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`.  _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-        },
-        "longread_qc_qualityfilter_targetbases": {
-          "type": "integer",
-          "default": 500000000,
-          "description": "Specify the number of high-quality bases in the library to be retained",
-          "fa_icon": "fas fa-bullseye",
-          "help_text": "Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
-        }
-      },
-      "fa_icon": "fas fa-expand-alt"
-    },
-    "preprocessing_host_removal_options": {
-      "title": "Preprocessing host removal options",
-      "type": "object",
-      "description": "Options for pre-profiling host read removal",
-      "default": "",
-      "properties": {
-        "perform_shortread_hostremoval": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on short-read host removal",
-          "help_text": "Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-        },
-        "perform_longread_hostremoval": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on long-read host removal",
-          "help_text": "Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
-        },
-        "hostremoval_reference": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-file-alt",
-          "description": "Specify path to single reference FASTA of host(s) genome(s)",
-          "help_text": "Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
-        },
-        "shortread_hostremoval_index": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-address-book",
-          "description": "Specify path to the directory containing pre-made BowTie2 indexes of the host removal reference",
-          "help_text": "Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-        },
-        "longread_hostremoval_index": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-address-book",
-          "description": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
-          "help_text": "Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
-        },
-        "save_hostremoval_index": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save mapping index of input reference when not already supplied by user",
-          "help_text": "Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
-        },
-        "save_hostremoval_mapped": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save mapped reads in BAM format from host removal",
-          "help_text": "Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
-        },
-        "save_hostremoval_unmapped": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save unmapped reads in FASTQ format from host removal",
-          "help_text": "Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
-        }
-      },
-      "fa_icon": "fas fa-user-times"
-    },
-    "preprocessing_run_merging_options": {
-      "title": "Preprocessing run merging options",
-      "type": "object",
-      "description": "Options for per-sample run-merging",
-      "default": "",
-      "properties": {
-        "perform_runmerging": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on run merging",
-          "help_text": "Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable.  "
-        },
-        "save_runmerged_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Save run-concatenated input FASTQ files for each sample",
-          "help_text": "Save the run- and library-concatenated reads of a given sample in FASTQ format."
-        }
-      },
-      "fa_icon": "fas fa-clipboard-check"
-    },
-    "profiling_options": {
-      "title": "Profiling options",
-      "type": "object",
-      "description": "",
-      "default": "",
-      "properties": {
-        "run_centrifuge": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with Centrifuge. Requires database to be present CSV file passed to --databases"
-        },
-        "centrifuge_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of Centrifuge-aligned reads",
-          "help_text": "Save mapped (SAM, FASTQ) and unmapped (FASTQ) reads from alignment step of centrifuge in your output results directory.\n\n> Modifies tool parameter(s):\n> - centrifuge: `--un-gz`, `--al-gz`, `--un-conc-gz`, `--al-conc-gz`, `--out-fmt`"
-        },
-        "run_diamond": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with DIAMOND. Requires database to be present CSV file passed to --databases"
-        },
-        "diamond_output_format": {
-          "type": "string",
-          "default": "tsv",
-          "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
-          "fa_icon": "fas fa-file",
-          "description": "Specify output format from DIAMOND profiling.",
-          "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
-        },
-        "diamond_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
-          "help_text": "Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
-        },
-        "run_kaiju": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with Kaiju. Requires database to be present CSV file passed to --databases"
-        },
-        "kaiju_taxon_rank": {
-          "type": "string",
-          "default": "species",
-          "enum": ["phylum", "class", "order", "family", "genus", "species"],
-          "fa_icon": "fas fa-tag",
-          "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
-          "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
-        },
-        "run_kraken2": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with Kraken2. Requires database to be present CSV file passed to --databases"
-        },
-        "kraken2_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of Kraken2-aligned reads",
-          "help_text": "Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
-        },
-        "kraken2_save_readclassification": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of Kraken2 per-read taxonomic assignment file",
-          "help_text": "Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
-        },
-        "kraken2_save_minimizers": {
-          "type": "boolean",
-          "description": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
-          "fa_icon": "fas fa-save",
-          "help_text": "Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
-        },
-        "run_bracken": {
-          "type": "boolean",
-          "description": "Post-process kraken2 reports with Bracken.",
-          "fa_icon": "fas fa-toggle-on"
-        },
-        "run_malt": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with MALT. Requires database to be present CSV file passed to --databases"
-        },
-        "malt_mode": {
-          "type": "string",
-          "default": "BlastN",
-          "fa_icon": "fas fa-check-square",
-          "description": "Specify which MALT alignment mode to use",
-          "help_text": "Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
-        },
-        "malt_save_reads": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on saving of MALT-aligned reads",
-          "help_text": "Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
-        },
-        "malt_generate_megansummary": {
-          "type": "boolean",
-          "fa_icon": "fas fa-save",
-          "description": "Turn on generation of MEGAN summary file from MALT results",
-          "help_text": "Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
-        },
-        "run_metaphlan3": {
-          "type": "boolean",
-          "description": "Turn on profiling with MetaPhlAn3. Requires database to be present CSV file passed to --databases",
-          "fa_icon": "fas fa-toggle-on"
-        },
-        "run_motus": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
-        }
-      },
-      "fa_icon": "fas fa-align-center"
-    },
-    "postprocessing_and_visualisation_options": {
-      "title": "Postprocessing and visualisation options",
-      "type": "object",
-      "description": "",
-      "default": "",
-      "properties": {
-        "run_profile_standardisation": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on standardisation of taxon tables across profilers",
-          "help_text": "Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON   | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32               | 123             |\n| taxon_b | 1                 | 5                 |\n\nThis currently only is generated for mOTUs."
-        },
-        "generate_biom_output": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on generation of BIOM output (currently only applies to mOTUs)",
-          "help_text": "Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
-        },
-        "run_krona": {
-          "type": "boolean",
-          "fa_icon": "fas fa-toggle-on",
-          "description": "Turn on generation of Krona plots for supported profilers",
-          "help_text": "Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
-        },
-        "krona_taxonomy_directory": {
-          "type": "string",
-          "default": "None",
-          "fa_icon": "fas fa-folder-open",
-          "description": "Specify path to krona taxonomy directories (required for MALT krona plots)",
-          "help_text": "Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
-        }
-      },
-      "fa_icon": "fas fa-chart-line"
-    },
-    "institutional_config_options": {
-      "title": "Institutional config options",
-      "type": "object",
-      "fa_icon": "fas fa-university",
-      "description": "Parameters used to describe centralised config profiles. These should not be edited.",
-      "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
-      "properties": {
-        "custom_config_version": {
-          "type": "string",
-          "description": "Git commit id for Institutional configs.",
-          "default": "master",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "custom_config_base": {
-          "type": "string",
-          "description": "Base directory for Institutional configs.",
-          "default": "https://raw.githubusercontent.com/nf-core/configs/master",
-          "hidden": true,
-          "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_name": {
-          "type": "string",
-          "description": "Institutional config name.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_description": {
-          "type": "string",
-          "description": "Institutional config description.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_contact": {
-          "type": "string",
-          "description": "Institutional config contact information.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        },
-        "config_profile_url": {
-          "type": "string",
-          "description": "Institutional config URL link.",
-          "hidden": true,
-          "fa_icon": "fas fa-users-cog"
-        }
-      }
-    },
-    "max_job_request_options": {
-      "title": "Max job request options",
-      "type": "object",
-      "fa_icon": "fab fa-acquisitions-incorporated",
-      "description": "Set the top limit for requested resources for any single job.",
-      "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
-      "properties": {
-        "max_cpus": {
-          "type": "integer",
-          "description": "Maximum number of CPUs that can be requested for any single job.",
-          "default": 16,
-          "fa_icon": "fas fa-microchip",
-          "hidden": true,
-          "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
-        },
-        "max_memory": {
-          "type": "string",
-          "description": "Maximum amount of memory that can be requested for any single job.",
-          "default": "128.GB",
-          "fa_icon": "fas fa-memory",
-          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-          "hidden": true,
-          "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
-        },
-        "max_time": {
-          "type": "string",
-          "description": "Maximum amount of time that can be requested for any single job.",
-          "default": "240.h",
-          "fa_icon": "far fa-clock",
-          "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
-          "hidden": true,
-          "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
-        }
-      }
-    },
-    "generic_options": {
-      "title": "Generic options",
-      "type": "object",
-      "fa_icon": "fas fa-file-import",
-      "description": "Less common options for the pipeline, typically set in a config file.",
-      "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
-      "properties": {
-        "help": {
-          "type": "boolean",
-          "description": "Display help text.",
-          "fa_icon": "fas fa-question-circle",
-          "hidden": true
-        },
-        "publish_dir_mode": {
-          "type": "string",
-          "default": "copy",
-          "description": "Method used to save pipeline results to output directory.",
-          "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
-          "fa_icon": "fas fa-copy",
-          "enum": [
-            "symlink",
-            "rellink",
-            "link",
-            "copy",
-            "copyNoFollow",
-            "move"
-          ],
-          "hidden": true
-        },
-        "email_on_fail": {
-          "type": "string",
-          "description": "Email address for completion summary, only when pipeline fails.",
-          "fa_icon": "fas fa-exclamation-triangle",
-          "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
-          "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
-          "hidden": true
-        },
-        "plaintext_email": {
-          "type": "boolean",
-          "description": "Send plain-text email instead of HTML.",
-          "fa_icon": "fas fa-remove-format",
-          "hidden": true
-        },
-        "max_multiqc_email_size": {
-          "type": "string",
-          "description": "File size limit when attaching MultiQC reports to summary emails.",
-          "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
-          "default": "25.MB",
-          "fa_icon": "fas fa-file-upload",
-          "hidden": true
-        },
-        "preprocessing_qc_tool": {
-          "type": "string",
-          "default": "fastqc",
-          "enum": ["fastqc", "falco"],
-          "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
-          "description": "Specify the tool used for quality control of raw sequencing reads"
-        },
-        "monochrome_logs": {
-          "type": "boolean",
-          "description": "Do not use coloured log outputs.",
-          "fa_icon": "fas fa-palette",
-          "hidden": true
-        },
-        "hook_url": {
-          "type": "string",
-          "description": "Incoming hook URL for messaging service",
-          "fa_icon": "fas fa-people-group",
-          "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
-          "hidden": true
-        },
-        "multiqc_config": {
-          "type": "string",
-          "description": "Custom config file to supply to MultiQC.",
-          "fa_icon": "fas fa-cog",
-          "hidden": true
-        },
-        "multiqc_logo": {
-          "type": "string",
-          "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
-          "fa_icon": "fas fa-image",
-          "hidden": true
-        },
-        "multiqc_methods_description": {
-          "type": "string",
-          "description": "Custom MultiQC yaml file containing HTML including a methods description.",
-          "fa_icon": "fas fa-cog"
-        },
-        "tracedir": {
-          "type": "string",
-          "description": "Directory to keep pipeline Nextflow logs and reports.",
-          "default": "${params.outdir}/pipeline_info",
-          "fa_icon": "fas fa-cogs",
-          "hidden": true
-        },
-        "validate_params": {
-          "type": "boolean",
-          "description": "Boolean whether to validate parameters against the schema at runtime",
-          "default": true,
-          "fa_icon": "fas fa-check-square",
-          "hidden": true
-        },
-        "show_hidden_params": {
-          "type": "boolean",
-          "fa_icon": "far fa-eye-slash",
-          "description": "Show all params when using `--help`",
-          "hidden": true,
-          "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
-        },
-        "enable_conda": {
-          "type": "boolean",
-          "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
-          "hidden": true,
-          "fa_icon": "fas fa-bacon"
-        }
-      }
-    },
-    "reference_genome_options": {
-      "title": "Reference genome options",
-      "type": "object",
-      "fa_icon": "fas fa-dna",
-      "description": "Reference genome related files and options required for the workflow.",
-      "properties": {
-        "genome": {
-          "type": "string",
-          "description": "Name of iGenomes reference.",
-          "fa_icon": "fas fa-book",
-          "help_text": "If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
-          "hidden": true
-        },
-        "igenomes_base": {
-          "type": "string",
-          "format": "directory-path",
-          "description": "Directory / URL base for iGenomes references.",
-          "default": "s3://ngi-igenomes/igenomes",
-          "fa_icon": "fas fa-cloud-download-alt",
-          "hidden": true
-        },
-        "igenomes_ignore": {
-          "type": "boolean",
-          "description": "Do not load the iGenomes reference config.",
-          "fa_icon": "fas fa-ban",
-          "hidden": true,
-          "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
-        }
-      }
-    }
-  },
-  "allOf": [
-    {
-      "$ref": "#/definitions/input_output_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_general_qc_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_short_read_qc_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_long_read_qc_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_host_removal_options"
-    },
-    {
-      "$ref": "#/definitions/preprocessing_run_merging_options"
-    },
-    {
-      "$ref": "#/definitions/profiling_options"
-    },
-    {
-      "$ref": "#/definitions/postprocessing_and_visualisation_options"
-    },
-    {
-      "$ref": "#/definitions/institutional_config_options"
-    },
-    {
-      "$ref": "#/definitions/max_job_request_options"
-    },
-    {
-      "$ref": "#/definitions/generic_options"
-    },
-    {
-      "$ref": "#/definitions/reference_genome_options"
-    }
-  ],
-  "properties": {
-    "save_mgc_counts": {
-      "type": "boolean",
-      "description": "Save the mgc reads count for mOTUs."
-    },
-    "save_ncbi_id": {
-      "type": "boolean",
-      "description": "Print NCBI taxonomic id for mOTUs."
-    },
-    "save_read_counts": {
-      "type": "boolean",
-      "description": "Print mOTUs result as counts instead of relative abundances."
-    }
-  }
-}
+    ]
+}
\ No newline at end of file

From 933b820c198808b5d6a5336b0bae2b2a369eb982 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Tue, 29 Nov 2022 16:57:07 +0100
Subject: [PATCH 18/25] Apply review suggestions

---
 conf/modules.config    |  6 +++---
 conf/test_motus.config |  6 +++---
 nextflow.config        |  6 +++---
 nextflow_schema.json   | 29 +++++++++++------------------
 4 files changed, 20 insertions(+), 27 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index 0f54301..63be9ff 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -448,9 +448,9 @@ process {
     withName: MOTUS_PROFILE {
         ext.args = {
             [
-                params.save_ncbi_id ? "-p" : "",
-                params.save_read_counts ? "-c" : "",
-                params.save_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
+                params.motus_ncbi_id ? "-p" : "",
+                params.motus_read_counts ? "-c" : "",
+                params.motus_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
             ].join(',').replaceAll(','," ")
             }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
diff --git a/conf/test_motus.config b/conf/test_motus.config
index 70681dd..8eb324b 100644
--- a/conf/test_motus.config
+++ b/conf/test_motus.config
@@ -39,8 +39,8 @@ params {
     run_centrifuge                        = false
     run_diamond                           = false
     run_motus                             = true
-    save_mgc_counts                       = true
-    save_ncbi_id                          = true
-    save_read_counts                      = true
+    motus_mgc_counts                       = true
+    motus_ncbi_id                          = true
+    motus_read_counts                      = true
     run_profile_standardisation           = true
 }
diff --git a/nextflow.config b/nextflow.config
index 91875b2..c9bb0f4 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -140,9 +140,9 @@ params {
 
     // mOTUs
     run_motus                  = false
-    save_mgc_counts            = false
-    save_ncbi_id               = false
-    save_read_counts           = false
+    motus_mgc_counts            = false
+    motus_ncbi_id               = false
+    motus_read_counts           = false
 
     // krona
     run_krona                  = false
diff --git a/nextflow_schema.json b/nextflow_schema.json
index cec0ab7..0b20762 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -63,7 +63,10 @@
                 "preprocessing_qc_tool": {
                     "type": "string",
                     "default": "fastqc",
-                    "enum": ["fastqc", "falco"],
+                    "enum": [
+                        "fastqc",
+                        "falco"
+                    ],
                     "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
                     "description": "Specify the tool used for quality control of raw sequencing reads",
                     "fa_icon": "fas fa-tools"
@@ -470,17 +473,17 @@
                     "fa_icon": "fas fa-toggle-on",
                     "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
                 },
-                "save_mgc_counts": {
+                "motus_mgc_counts": {
                     "type": "boolean",
-                    "description": "Save the mgc reads count for mOTUs."
+                    "description": "Save the mgc reads count."
                 },
-                "save_read_counts": {
+                "motus_ncbi_id": {
                     "type": "boolean",
-                    "description": "Print mOTUs result as counts instead of relative abundances."
+                    "description": "Print NCBI id."
                 },
-                "save_ncbi_id": {
+                "motus_read_counts": {
                     "type": "boolean",
-                    "description": "Print NCBI taxonomic id for mOTUs."
+                    "description": "Print result as counts instead of relative abundances."
                 }
             },
             "fa_icon": "fas fa-align-center"
@@ -653,16 +656,6 @@
                     "fa_icon": "fas fa-file-upload",
                     "hidden": true
                 },
-                "preprocessing_qc_tool": {
-                    "type": "string",
-                    "default": "fastqc",
-                    "enum": [
-                        "fastqc",
-                        "falco"
-                    ],
-                    "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
-                    "description": "Specify the tool used for quality control of raw sequencing reads"
-                },
                 "monochrome_logs": {
                     "type": "boolean",
                     "description": "Do not use coloured log outputs.",
@@ -791,4 +784,4 @@
             "$ref": "#/definitions/reference_genome_options"
         }
     ]
-}
\ No newline at end of file
+}

From 8067012c01c1e29803a5365529cd139d463543eb Mon Sep 17 00:00:00 2001
From: nf-core-bot <core@nf-co.re>
Date: Thu, 1 Dec 2022 09:15:35 +0000
Subject: [PATCH 19/25] [automated] Fix linting with Prettier

---
 nextflow_schema.json | 55 +++++++-------------------------------------
 1 file changed, 8 insertions(+), 47 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index 0b20762..2fcdd80 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -10,11 +10,7 @@
             "type": "object",
             "fa_icon": "fas fa-terminal",
             "description": "Define where the pipeline should find input data and save output data.",
-            "required": [
-                "input",
-                "databases",
-                "outdir"
-            ],
+            "required": ["input", "databases", "outdir"],
             "properties": {
                 "input": {
                     "type": "string",
@@ -63,10 +59,7 @@
                 "preprocessing_qc_tool": {
                     "type": "string",
                     "default": "fastqc",
-                    "enum": [
-                        "fastqc",
-                        "falco"
-                    ],
+                    "enum": ["fastqc", "falco"],
                     "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
                     "description": "Specify the tool used for quality control of raw sequencing reads",
                     "fa_icon": "fas fa-tools"
@@ -95,10 +88,7 @@
                 "shortread_qc_tool": {
                     "type": "string",
                     "default": "fastp",
-                    "enum": [
-                        "fastp",
-                        "adapterremoval"
-                    ],
+                    "enum": ["fastp", "adapterremoval"],
                     "fa_icon": "fas fa-tools",
                     "description": "Specify which tool to use for short-read QC"
                 },
@@ -157,11 +147,7 @@
                 "shortread_complexityfilter_tool": {
                     "type": "string",
                     "default": "bbduk",
-                    "enum": [
-                        "bbduk",
-                        "prinseqplusplus",
-                        "fastp"
-                    ],
+                    "enum": ["bbduk", "prinseqplusplus", "fastp"],
                     "fa_icon": "fas fa-hammer",
                     "description": "Specify which tool to use for complexity filtering"
                 },
@@ -195,10 +181,7 @@
                 "shortread_complexityfilter_prinseqplusplus_mode": {
                     "type": "string",
                     "default": "entropy",
-                    "enum": [
-                        "entropy",
-                        "dust"
-                    ],
+                    "enum": ["entropy", "dust"],
                     "fa_icon": "fas fa-check-square",
                     "description": "Specify the complexity filter mode for PRINSEQ++"
                 },
@@ -372,15 +355,7 @@
                 "diamond_output_format": {
                     "type": "string",
                     "default": "tsv",
-                    "enum": [
-                        "blast",
-                        "xml",
-                        "txt",
-                        "daa",
-                        "sam",
-                        "tsv",
-                        "paf"
-                    ],
+                    "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
                     "fa_icon": "fas fa-file",
                     "description": "Specify output format from DIAMOND profiling.",
                     "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
@@ -399,14 +374,7 @@
                 "kaiju_taxon_rank": {
                     "type": "string",
                     "default": "species",
-                    "enum": [
-                        "phylum",
-                        "class",
-                        "order",
-                        "family",
-                        "genus",
-                        "species"
-                    ],
+                    "enum": ["phylum", "class", "order", "family", "genus", "species"],
                     "fa_icon": "fas fa-tag",
                     "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
                     "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
@@ -624,14 +592,7 @@
                     "description": "Method used to save pipeline results to output directory.",
                     "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                     "fa_icon": "fas fa-copy",
-                    "enum": [
-                        "symlink",
-                        "rellink",
-                        "link",
-                        "copy",
-                        "copyNoFollow",
-                        "move"
-                    ],
+                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
                     "hidden": true
                 },
                 "email_on_fail": {

From e5bb627402179b42ef817845db8c99a0546c4a16 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Thu, 1 Dec 2022 11:12:31 +0100
Subject: [PATCH 20/25] Apply review suggestions

---
 conf/modules.config    |  6 ++--
 conf/test_motus.config |  6 ++--
 nextflow.config        |  6 ++--
 nextflow_schema.json   | 73 ++++++++++++++++++++++++++++++++----------
 4 files changed, 65 insertions(+), 26 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index 63be9ff..1ff6f55 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -448,9 +448,9 @@ process {
     withName: MOTUS_PROFILE {
         ext.args = {
             [
-                params.motus_ncbi_id ? "-p" : "",
-                params.motus_read_counts ? "-c" : "",
-                params.motus_mgc_counts ?  "-M ${task.ext.prefix}.mgc" : ""
+                params.motus_use_ncbi_ids ? "-p" : "",
+                params.motus_output_type ? "-c" : "",
+                params.motus_save_mgcreadcounts ?  "-M ${task.ext.prefix}.mgc" : ""
             ].join(',').replaceAll(','," ")
             }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
diff --git a/conf/test_motus.config b/conf/test_motus.config
index 8eb324b..b5c2c51 100644
--- a/conf/test_motus.config
+++ b/conf/test_motus.config
@@ -39,8 +39,8 @@ params {
     run_centrifuge                        = false
     run_diamond                           = false
     run_motus                             = true
-    motus_mgc_counts                       = true
-    motus_ncbi_id                          = true
-    motus_read_counts                      = true
+    motus_save_mgcreadcounts              = true
+    motus_use_ncbi_ids                    = true
+    motus_output_type                     = true
     run_profile_standardisation           = true
 }
diff --git a/nextflow.config b/nextflow.config
index c9bb0f4..b1da76a 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -140,9 +140,9 @@ params {
 
     // mOTUs
     run_motus                  = false
-    motus_mgc_counts            = false
-    motus_ncbi_id               = false
-    motus_read_counts           = false
+    motus_output_type          = false
+    motus_use_ncbi_ids         = false
+    motus_save_mgcreadcounts   = false
 
     // krona
     run_krona                  = false
diff --git a/nextflow_schema.json b/nextflow_schema.json
index 2fcdd80..7c4998a 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -10,7 +10,11 @@
             "type": "object",
             "fa_icon": "fas fa-terminal",
             "description": "Define where the pipeline should find input data and save output data.",
-            "required": ["input", "databases", "outdir"],
+            "required": [
+                "input",
+                "databases",
+                "outdir"
+            ],
             "properties": {
                 "input": {
                     "type": "string",
@@ -59,7 +63,10 @@
                 "preprocessing_qc_tool": {
                     "type": "string",
                     "default": "fastqc",
-                    "enum": ["fastqc", "falco"],
+                    "enum": [
+                        "fastqc",
+                        "falco"
+                    ],
                     "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
                     "description": "Specify the tool used for quality control of raw sequencing reads",
                     "fa_icon": "fas fa-tools"
@@ -88,7 +95,10 @@
                 "shortread_qc_tool": {
                     "type": "string",
                     "default": "fastp",
-                    "enum": ["fastp", "adapterremoval"],
+                    "enum": [
+                        "fastp",
+                        "adapterremoval"
+                    ],
                     "fa_icon": "fas fa-tools",
                     "description": "Specify which tool to use for short-read QC"
                 },
@@ -147,7 +157,11 @@
                 "shortread_complexityfilter_tool": {
                     "type": "string",
                     "default": "bbduk",
-                    "enum": ["bbduk", "prinseqplusplus", "fastp"],
+                    "enum": [
+                        "bbduk",
+                        "prinseqplusplus",
+                        "fastp"
+                    ],
                     "fa_icon": "fas fa-hammer",
                     "description": "Specify which tool to use for complexity filtering"
                 },
@@ -181,7 +195,10 @@
                 "shortread_complexityfilter_prinseqplusplus_mode": {
                     "type": "string",
                     "default": "entropy",
-                    "enum": ["entropy", "dust"],
+                    "enum": [
+                        "entropy",
+                        "dust"
+                    ],
                     "fa_icon": "fas fa-check-square",
                     "description": "Specify the complexity filter mode for PRINSEQ++"
                 },
@@ -355,7 +372,15 @@
                 "diamond_output_format": {
                     "type": "string",
                     "default": "tsv",
-                    "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
+                    "enum": [
+                        "blast",
+                        "xml",
+                        "txt",
+                        "daa",
+                        "sam",
+                        "tsv",
+                        "paf"
+                    ],
                     "fa_icon": "fas fa-file",
                     "description": "Specify output format from DIAMOND profiling.",
                     "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
@@ -374,7 +399,14 @@
                 "kaiju_taxon_rank": {
                     "type": "string",
                     "default": "species",
-                    "enum": ["phylum", "class", "order", "family", "genus", "species"],
+                    "enum": [
+                        "phylum",
+                        "class",
+                        "order",
+                        "family",
+                        "genus",
+                        "species"
+                    ],
                     "fa_icon": "fas fa-tag",
                     "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
                     "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
@@ -441,17 +473,17 @@
                     "fa_icon": "fas fa-toggle-on",
                     "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
                 },
-                "motus_mgc_counts": {
-                    "type": "boolean",
-                    "description": "Save the mgc reads count."
+                "motus_use_ncbi_ids": {
+                    "type": "string",
+                    "default": "false"
                 },
-                "motus_ncbi_id": {
-                    "type": "boolean",
-                    "description": "Print NCBI id."
+                "motus_save_mgcreadcounts": {
+                    "type": "string",
+                    "default": "false"
                 },
-                "motus_read_counts": {
-                    "type": "boolean",
-                    "description": "Print result as counts instead of relative abundances."
+                "motus_output_type": {
+                    "type": "string",
+                    "default": "false"
                 }
             },
             "fa_icon": "fas fa-align-center"
@@ -592,7 +624,14 @@
                     "description": "Method used to save pipeline results to output directory.",
                     "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                     "fa_icon": "fas fa-copy",
-                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
+                    "enum": [
+                        "symlink",
+                        "rellink",
+                        "link",
+                        "copy",
+                        "copyNoFollow",
+                        "move"
+                    ],
                     "hidden": true
                 },
                 "email_on_fail": {

From 1965ade961c93c5efaf8fc6fee93af9838a788a8 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Thu, 1 Dec 2022 11:32:51 +0100
Subject: [PATCH 21/25] Update schema

---
 nextflow_schema.json | 12 ++++++------
 1 file changed, 6 insertions(+), 6 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index 7c4998a..2864a52 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -474,16 +474,16 @@
                     "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
                 },
                 "motus_use_ncbi_ids": {
-                    "type": "string",
-                    "default": "false"
+                    "type": "boolean",
+                    "description": "Turn on printing ncbi taxonomic ids."
                 },
                 "motus_save_mgcreadcounts": {
-                    "type": "string",
-                    "default": "false"
+                    "type": "boolean",
+                    "description": "Turn on saving the mgc reads count to a separate file."
                 },
                 "motus_output_type": {
-                    "type": "string",
-                    "default": "false"
+                    "type": "boolean",
+                    "description": "Turn on printing result as counts instead of relative abundances."
                 }
             },
             "fa_icon": "fas fa-align-center"

From 38a818fd174718229385a0ed301c42c76cadb9ec Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Thu, 1 Dec 2022 13:42:21 +0100
Subject: [PATCH 22/25] Apply review suggestions

---
 conf/modules.config    |  6 +++---
 conf/test_motus.config |  6 +++---
 nextflow.config        |  8 ++++----
 nextflow_schema.json   | 28 +++++++++++++++-------------
 4 files changed, 25 insertions(+), 23 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index 1ff6f55..43e179d 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -448,9 +448,9 @@ process {
     withName: MOTUS_PROFILE {
         ext.args = {
             [
-                params.motus_use_ncbi_ids ? "-p" : "",
-                params.motus_output_type ? "-c" : "",
-                params.motus_save_mgcreadcounts ?  "-M ${task.ext.prefix}.mgc" : ""
+                params.motus_remove_ncbi_ids ? "" : "-p",
+                params.motus_use_relative_abundance ? "" : "-c",
+                params.motus_save_mgc_read_counts ?  "-M ${task.ext.prefix}.mgc" : ""
             ].join(',').replaceAll(','," ")
             }
         ext.prefix = params.perform_runmerging ? { "${meta.id}-${meta.db_name}" } : { "${meta.id}-${meta.run_accession}-${meta.db_name}" }
diff --git a/conf/test_motus.config b/conf/test_motus.config
index b5c2c51..92c9a91 100644
--- a/conf/test_motus.config
+++ b/conf/test_motus.config
@@ -39,8 +39,8 @@ params {
     run_centrifuge                        = false
     run_diamond                           = false
     run_motus                             = true
-    motus_save_mgcreadcounts              = true
-    motus_use_ncbi_ids                    = true
-    motus_output_type                     = true
+    motus_save_mgc_read_counts            = true
+    motus_remove_ncbi_ids                 = true
+    motus_use_relative_abundance          = true
     run_profile_standardisation           = true
 }
diff --git a/nextflow.config b/nextflow.config
index b1da76a..84c5242 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -139,10 +139,10 @@ params {
     diamond_save_reads         = false // this will override default diamond output format so no taxonomic profile is generated! added directly to module in profiling.nf
 
     // mOTUs
-    run_motus                  = false
-    motus_output_type          = false
-    motus_use_ncbi_ids         = false
-    motus_save_mgcreadcounts   = false
+    run_motus                       = false
+    motus_use_relative_abundance    = false
+    motus_remove_ncbi_ids           = false
+    motus_save_mgc_read_counts      = false
 
     // krona
     run_krona                  = false
diff --git a/nextflow_schema.json b/nextflow_schema.json
index 2864a52..e6db686 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -472,18 +472,6 @@
                     "type": "boolean",
                     "fa_icon": "fas fa-toggle-on",
                     "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
-                },
-                "motus_use_ncbi_ids": {
-                    "type": "boolean",
-                    "description": "Turn on printing ncbi taxonomic ids."
-                },
-                "motus_save_mgcreadcounts": {
-                    "type": "boolean",
-                    "description": "Turn on saving the mgc reads count to a separate file."
-                },
-                "motus_output_type": {
-                    "type": "boolean",
-                    "description": "Turn on printing result as counts instead of relative abundances."
                 }
             },
             "fa_icon": "fas fa-align-center"
@@ -783,5 +771,19 @@
         {
             "$ref": "#/definitions/reference_genome_options"
         }
-    ]
+    ],
+    "properties": {
+        "motus_use_relative_abundance": {
+            "type": "string",
+            "default": "false"
+        },
+        "motus_remove_ncbi_ids": {
+            "type": "string",
+            "default": "false"
+        },
+        "motus_save_mgc_read_counts": {
+            "type": "string",
+            "default": "false"
+        }
+    }
 }

From 4800a5f03ee654ed2cb16f3b7bf273c29bf95b18 Mon Sep 17 00:00:00 2001
From: sofstam <sofia.stamouli@scilifelab.se>
Date: Thu, 1 Dec 2022 14:23:40 +0100
Subject: [PATCH 23/25] Update schema

---
 nextflow_schema.json | 28 +++++++++++++---------------
 1 file changed, 13 insertions(+), 15 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index e6db686..8d473a9 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -472,6 +472,18 @@
                     "type": "boolean",
                     "fa_icon": "fas fa-toggle-on",
                     "description": "Turn on profiling with mOTUs. Requires database to be present CSV file passed to --databases"
+                },
+                "motus_use_relative_abundance": {
+                    "type": "boolean",
+                    "description": "Turn on printing relative abundance instead of counts."
+                },
+                "motus_save_mgc_read_counts": {
+                    "type": "boolean",
+                    "description": "Turn on saving the mgc reads count."
+                },
+                "motus_remove_ncbi_ids": {
+                    "type": "boolean",
+                    "description": "Turn on removing NCBI taxonomic IDs."
                 }
             },
             "fa_icon": "fas fa-align-center"
@@ -771,19 +783,5 @@
         {
             "$ref": "#/definitions/reference_genome_options"
         }
-    ],
-    "properties": {
-        "motus_use_relative_abundance": {
-            "type": "string",
-            "default": "false"
-        },
-        "motus_remove_ncbi_ids": {
-            "type": "string",
-            "default": "false"
-        },
-        "motus_save_mgc_read_counts": {
-            "type": "string",
-            "default": "false"
-        }
-    }
+    ]
 }

From 410196c37b740fcc60e382ae3ba7142a2dc7341a Mon Sep 17 00:00:00 2001
From: nf-core-bot <core@nf-co.re>
Date: Thu, 1 Dec 2022 14:33:34 +0000
Subject: [PATCH 24/25] [automated] Fix linting with Prettier

---
 nextflow_schema.json | 55 +++++++-------------------------------------
 1 file changed, 8 insertions(+), 47 deletions(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index 8d473a9..3468f64 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -10,11 +10,7 @@
             "type": "object",
             "fa_icon": "fas fa-terminal",
             "description": "Define where the pipeline should find input data and save output data.",
-            "required": [
-                "input",
-                "databases",
-                "outdir"
-            ],
+            "required": ["input", "databases", "outdir"],
             "properties": {
                 "input": {
                     "type": "string",
@@ -63,10 +59,7 @@
                 "preprocessing_qc_tool": {
                     "type": "string",
                     "default": "fastqc",
-                    "enum": [
-                        "fastqc",
-                        "falco"
-                    ],
+                    "enum": ["fastqc", "falco"],
                     "help_text": "Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
                     "description": "Specify the tool used for quality control of raw sequencing reads",
                     "fa_icon": "fas fa-tools"
@@ -95,10 +88,7 @@
                 "shortread_qc_tool": {
                     "type": "string",
                     "default": "fastp",
-                    "enum": [
-                        "fastp",
-                        "adapterremoval"
-                    ],
+                    "enum": ["fastp", "adapterremoval"],
                     "fa_icon": "fas fa-tools",
                     "description": "Specify which tool to use for short-read QC"
                 },
@@ -157,11 +147,7 @@
                 "shortread_complexityfilter_tool": {
                     "type": "string",
                     "default": "bbduk",
-                    "enum": [
-                        "bbduk",
-                        "prinseqplusplus",
-                        "fastp"
-                    ],
+                    "enum": ["bbduk", "prinseqplusplus", "fastp"],
                     "fa_icon": "fas fa-hammer",
                     "description": "Specify which tool to use for complexity filtering"
                 },
@@ -195,10 +181,7 @@
                 "shortread_complexityfilter_prinseqplusplus_mode": {
                     "type": "string",
                     "default": "entropy",
-                    "enum": [
-                        "entropy",
-                        "dust"
-                    ],
+                    "enum": ["entropy", "dust"],
                     "fa_icon": "fas fa-check-square",
                     "description": "Specify the complexity filter mode for PRINSEQ++"
                 },
@@ -372,15 +355,7 @@
                 "diamond_output_format": {
                     "type": "string",
                     "default": "tsv",
-                    "enum": [
-                        "blast",
-                        "xml",
-                        "txt",
-                        "daa",
-                        "sam",
-                        "tsv",
-                        "paf"
-                    ],
+                    "enum": ["blast", "xml", "txt", "daa", "sam", "tsv", "paf"],
                     "fa_icon": "fas fa-file",
                     "description": "Specify output format from DIAMOND profiling.",
                     "help_text": "DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
@@ -399,14 +374,7 @@
                 "kaiju_taxon_rank": {
                     "type": "string",
                     "default": "species",
-                    "enum": [
-                        "phylum",
-                        "class",
-                        "order",
-                        "family",
-                        "genus",
-                        "species"
-                    ],
+                    "enum": ["phylum", "class", "order", "family", "genus", "species"],
                     "fa_icon": "fas fa-tag",
                     "description": "Specify taxonomic rank to be displayed in Kaiju taxon table",
                     "help_text": "Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
@@ -624,14 +592,7 @@
                     "description": "Method used to save pipeline results to output directory.",
                     "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                     "fa_icon": "fas fa-copy",
-                    "enum": [
-                        "symlink",
-                        "rellink",
-                        "link",
-                        "copy",
-                        "copyNoFollow",
-                        "move"
-                    ],
+                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
                     "hidden": true
                 },
                 "email_on_fail": {

From 7e7299203c9e8e21242eb3fd9cc51b913d8f7816 Mon Sep 17 00:00:00 2001
From: Sofia Stamouli <91951607+sofstam@users.noreply.github.com>
Date: Fri, 2 Dec 2022 08:55:23 +0100
Subject: [PATCH 25/25] Set values to false

---
 conf/test_motus.config | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/conf/test_motus.config b/conf/test_motus.config
index 29808ed..ee41447 100644
--- a/conf/test_motus.config
+++ b/conf/test_motus.config
@@ -44,8 +44,8 @@ params {
     run_diamond                           = false
     run_krakenuniq                        = false
     run_motus                             = true
-    motus_save_mgc_read_counts            = true
-    motus_remove_ncbi_ids                 = true
-    motus_use_relative_abundance          = true
+    motus_save_mgc_read_counts            = false
+    motus_remove_ncbi_ids                 = false
+    motus_use_relative_abundance          = false
     run_profile_standardisation           = true
 }