SequenceVariation.jl/docs/src/haplotypes.md

CurrentModule = SequenceVariation

Working with haplotypes

Calling variants

The first step in working with sequence variation is to identify (call) variations between two sequences. SequenceVariation can directly call variants using the Haplotype(::PairwiseAlignment) constructor of the Haplotype type.

using SequenceVariation, BioAlignments, BioSequences

bovine = dna"GACCGGCTGCATTCGAGGCTGCCAGCAAGCAG";
ovine  = dna"GACCGGCTGCATTCGAGGCTGTCAGCAAACAG";
human  = dna"GACAGGCTGCATCAGAAGAGGCCATCAAGCAG";

bos_ovis_alignment =
    PairwiseAlignment(AlignedSequence(ovine, Alignment("32M", 1, 1)), bovine);
bos_human_alignment =
    PairwiseAlignment(AlignedSequence(human, Alignment("32M", 1, 1)), bovine);

bos_ovis_haplotype = Haplotype(bos_ovis_alignment)
bos_human_haplotype = Haplotype(bos_human_alignment)

Sequence reconstruction

If the alternate sequence of a haplotype is no longer available (as is often the case when calling variants from alignment files), then the sequence can be retrieved using the reconstruct function.

human2 = reconstruct(bos_human_haplotype)
human2 == bovine
human2 == human

Reference switching

All variations within a haplotype can be mapped to a new reference sequence given an alignment between the new and old references using the [translate](@ref translate(::Haplotype{S,T}, ::PairwiseAlignment{S,S}) where {S,T}) function. This could be useful if variants were called against a reference sequence for the entire species, but need to be analyzed as variants of a subtype later.

ovis_human_alignment =
    PairwiseAlignment(AlignedSequence(human, Alignment("32M", 1, 1)), ovine)
SequenceVariation.translate(bos_ovis_haplotype, ovis_human_alignment)