adding fasttree module (#412)

* adding fasttree module

* correct trailing whitespace

* using sarscov2 as a test dir

* remove TODO

* update test data naming

* further test data naming updates

* remove options in favour of $options.args

* ensure non standard exit codes don't cause an issue

* update md5sum

software/fasttree/functions.nf

@@ -0,0 +1,60 @@
+/*
+ * -----------------------------------------------------
+ *  Utility functions used in nf-core DSL2 module files
+ * -----------------------------------------------------
+ */
+
+/*
+ * Extract name of software tool from process name using $task.process
+ */
+def getSoftwareName(task_process) {
+    return task_process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()
+}
+
+/*
+ * Function to initialise default values and to generate a Groovy Map of available options for nf-core modules
+ */
+def initOptions(Map args) {
+    def Map options = [:]
+    options.args          = args.args ?: ''
+    options.args2         = args.args2 ?: ''
+    options.args3         = args.args3 ?: ''
+    options.publish_by_id = args.publish_by_id ?: false
+    options.publish_dir   = args.publish_dir ?: ''
+    options.publish_files = args.publish_files
+    options.suffix        = args.suffix ?: ''
+    return options
+}
+
+/*
+ * Tidy up and join elements of a list to return a path string
+ */
+def getPathFromList(path_list) {
+    def paths = path_list.findAll { item -> !item?.trim().isEmpty() }  // Remove empty entries
+    paths = paths.collect { it.trim().replaceAll("^[/]+|[/]+\$", "") } // Trim whitespace and trailing slashes
+    return paths.join('/')
+}
+
+/*
+ * Function to save/publish module results
+ */
+def saveFiles(Map args) {
+    if (!args.filename.endsWith('.version.txt')) {
+        def ioptions = initOptions(args.options)
+        def path_list = [ ioptions.publish_dir ?: args.publish_dir ]
+        if (ioptions.publish_by_id) {
+            path_list.add(args.publish_id)
+        }
+        if (ioptions.publish_files instanceof Map) {
+            for (ext in ioptions.publish_files) {
+                if (args.filename.endsWith(ext.key)) {
+                    def ext_list = path_list.collect()
+                    ext_list.add(ext.value)
+                    return "${getPathFromList(ext_list)}/$args.filename"
+                }
+            }
+        } else if (ioptions.publish_files == null) {
+            return "${getPathFromList(path_list)}/$args.filename"
+        }
+    }
+}

software/fasttree/main.nf

@@ -0,0 +1,38 @@
+// Import generic module functions
+include { initOptions; saveFiles; getSoftwareName } from './functions'
+
+params.options = [:]
+options        = initOptions(params.options)
+
+process FASTTREE {
+    label 'process_medium'
+    publishDir "${params.outdir}",
+        mode: params.publish_dir_mode,
+        saveAs: { filename -> saveFiles(filename:filename, options:params.options, publish_dir:getSoftwareName(task.process), publish_id:'') }
+
+    conda (params.enable_conda ? "bioconda::fasttree=2.1.10" : null)
+    if (workflow.containerEngine == 'singularity' && !params.singularity_pull_docker_container) {
+        container "https://depot.galaxyproject.org/singularity/fasttree:2.1.10--h516909a_4"
+    } else {
+        container "quay.io/biocontainers/fasttree:2.1.10--h516909a_4"
+    }
+
+    input:
+    path alignment
+
+    output:
+    path "*.tre",         emit: phylogeny
+    path "*.version.txt", emit: version
+
+    script:
+    def software = getSoftwareName(task.process)
+    """
+    fasttree \\
+        $options.args \\
+        -log fasttree_phylogeny.tre.log \\
+        -nt $alignment \\
+        > fasttree_phylogeny.tre
+
+    echo \$(fasttree -help 2>&1) | head -1  | sed 's/^FastTree \\([0-9\\.]*\\) .*\$/\\1/' > ${software}.version.txt
+    """
+}

software/fasttree/meta.yml

@@ -0,0 +1,32 @@
+name: fasttree
+description: Produces a Newick format phylogeny from a multiple sequence alignment. Capable of bacterial genome size alignments.
+keywords:
+  - phylogeny
+  - newick
+tools:
+  - fasttree:
+      description: FastTree infers approximately-maximum-likelihood phylogenetic trees from alignments of nucleotide or protein sequences
+      homepage: http://www.microbesonline.org/fasttree/
+      documentation: http://www.microbesonline.org/fasttree/#Usage
+      tool_dev_url: None
+      doi: ""
+      licence: ['GPL v2']
+
+input:
+  - alignment:
+      type: file
+      description: A FASTA format multiple sequence alignment file
+      pattern: "*.{fasta,fas,fa,mfa}"
+
+output:
+  - version:
+      type: file
+      description: File containing software version
+      pattern: "*.{version.txt}"
+  - phylogeny:
+      type: file
+      description: A phylogeny in Newick format
+      pattern: "*.{tre}"
+
+authors:
+  - "@aunderwo"

tests/config/pytest_software.yml

@@ -178,6 +178,10 @@ fastqc:
   - software/fastqc/**
   - tests/software/fastqc/**
 
+fasttree:
+  - software/fasttree/**
+  - tests/software/fasttree/**
+
 fgbio_callmolecularconsensusreads:
   - software/fgbio/callmolecularconsensusreads/**
   - tests/software/fgbio/callmolecularconsensusreads/**

tests/config/test_data.config

@@ -25,8 +25,9 @@ params {
                 kraken2_tar_gz                            = "${test_data_dir}/genomics/sarscov2/genome/db/kraken2.tar.gz"
                 
                 test_wig_gz                               = "${test_data_dir}/genomics/sarscov2/genome/gcwiggle/test.wig.gz"
-
-                test_fas                                  = "${test_data_dir}/genomics/sarscov2/genome/alignment/test.fas"
+                
+                all_sites_fas                             = "${test_data_dir}/genomics/sarscov2/genome/alignment/all_sites.fas"
+                informative_sites_fas                     = "${test_data_dir}/genomics/sarscov2/genome/alignment/informative_sites.fas"
             }
             'illumina' {
                 test_single_end_bam                       = "${test_data_dir}/genomics/sarscov2/illumina/bam/test_single_end.bam"

tests/data/genomics/sarscov2/genome/alignment/informative_sites.fas

@@ -0,0 +1,8 @@
+>sample1
+CCCCAGCCTTNTTGGTTCCTANNTCTACCCCTCTGTGGNCCGAGATGGGTCTAT
+>sample2
+TCTTGTATCCCCCGGCCTTCGGCCTCTAGATTCGCCGCNCTTGCTAAACCTGTG
+>sample3
+CCCCGGCCTCTCCGGCCCCTACTTCCACGCCTTTGCGGTTCGAGATGGGTCGTT
+>sample4
+TTCCGGCCCCTCCTTCCCCTAGCCCCACGCCCCTGCTCCCCGAGATAACCCGTG

tests/software/fasttree/main.nf

@@ -0,0 +1,12 @@
+#!/usr/bin/env nextflow
+
+nextflow.enable.dsl = 2
+
+include { FASTTREE } from '../../../software/fasttree/main.nf' addParams( options: [:] )
+
+workflow test_fasttree {
+    
+    input = [ file(params.test_data['sarscov2']['genome']['informative_sites_fas'], checkIfExists: true) ]
+
+    FASTTREE ( input )
+}

tests/software/fasttree/test.yml

@@ -0,0 +1,7 @@
+- name: fasttree
+  command: nextflow run ./tests/software/fasttree -entry test_fasttree -c tests/config/nextflow.config
+  tags:
+    - fasttree
+  files:
+    - path: output/fasttree/fasttree_phylogeny.tre
+      md5sum: 63a886117535847c1e66fa4487f3b7d2