"description":"Path to comma-separated file containing information about the samples and libraries/runs.",
"help_text":"You will need to create a design file with information about the samples and libraries/runs you want to running in your pipeline run. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/usage#samplesheet-input).",
"description":"Path to comma-separated file containing information about databases and profiling parameters for each taxonomic profiler",
"help_text":"You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 4 columns, and a header row. See [usage docs](https://nf-co.re/taxprofiler/dev/usage#full-database-sheet).\n\nProfilers will only be executed if a corresponding database are supplied. \n\nWe recommend storing this database sheet somewhere centrally and accessible by others members of your lab/institutions, as this file will likely be regularly reused."
"description":"Email address for completion summary.",
"fa_icon":"fas fa-envelope",
"help_text":"Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
"help_text":"Falco is designed as a drop-in replacement for FastQC but written in C++ for faster computation. We particularly recommend using falco when using long reads (due to reduced memory constraints), however is also applicable for short reads.",
"description":"Specify the tool used for quality control of raw sequencing reads",
"help_text":"This saves the FASTQ output from the following tools:\n\n- fastp\n- AdapterRemoval\n- Porechop\n- Filtlong\n\nThese reads will be a mixture of: adapter clipped, quality trimmed, pair-merged, and length filtered, depending on the parameters you set."
"help_text":"Turns on short read quality control steps (adapter clipping, complexity filtering etc.)\n\nThis subworkflow can perform:\n\n- Adapter removal\n- Read quality trimming\n- Read pair merging\n- Length filtering\n- Complexity filtering\n\nEither with fastp or AdapterRemoval.\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences. Note that some, but not all, tools support paired-end alignment (utilising information about the insert covered by the pairs). However read pair merging in some cases can be recommend to increase read length (such as in aDNA). Length filtering, and/or complexity can speed up alignment by reducing the number of short unspecific reads that need to be aligned."
"help_text":"Skip the removal of sequencing adapters. \n\nThis often can be useful to speed up run-time of the pipeline when analysing data downloaded from public databases such as the ENA or SRA, as adapters should already be removed (however we recommend to check FastQC results to ensure this is the case)."
"help_text":"Specify a custom forward or R1 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG`"
"help_text":"Specify a custom reverse or R2 adapter sequence to be removed from reads. \n\nIf not set, the selected short-read QC tool's defaults will be used.\n\n> Modifies tool parameter(s):\n> - fastp: `--adapter_sequence`. fastp default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT`\n> - AdapterRemoval: `--adapter1`. AdapteRemoval2 default: `AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT`"
"description":"Specify a list of all possible adapters to trim. Overrides --shortread_qc_adapter1/2. Formats: .txt (AdapterRemoval) or .fasta. (fastp).",
"help_text":"Allows to supply a file with a list of adapter (combinations) to remove from all files. \n\nOverrides the --shortread_qc_adapter1/--shortread_qc_adapter2 parameters . \n\nFor AdapterRemoval this consists of a two column table with a `.txt` extension: first column represents forward strand, second column for reverse strand. You must supply all possible combinations, one per line, and this list is applied to all files. See AdapterRemoval documentation for more information.\n\nFor fastp this consists of a standard FASTA format with a `.fasta`/`.fa`/`.fna`/`.fas` extension. The adapter sequence in this file should be at least 6bp long, otherwise it will be skipped. fastp trims the adapters present in the FASTA file one by one.\n\n> Modifies AdapterRemoval parameter: --adapter-list\n> Modifies fastp parameter: --adapter_fasta"
"description":"Turn on merging of read pairs for paired-end data",
"default":true,
"help_text":"Turn on the merging of read-pairs of paired-end short read sequencing data for AdapterRemoval (this is performed automatically with fastp).\n\n> Modifies tool parameter(s):\n> - AdapterRemoval: `--collapse`\n"
"help_text":"Turns off the inclusion of unmerged reads in resulting processing FASTQ file of paired-end sequencing data when using `fastp`.\n\nThis can be useful in cases where you prefer to have very short reads (e.g. aDNA), thus excluding longer-reads or possibly faulty reads where one of the pair was discarded.\n\n> Modifies tool parameter(s):\n> - removed from reads `--include_unmerged`\n"
"help_text":"Specifying a mimum read length filtering can speed up profiling by reducing the number of short unspecific reads that need to be match/aligned to the database.\n\n> Modifies tool parameter(s):\n> - removed from reads `--length_required`\n> - AdapterRemoval: `--minlength`"
"description":"Turns on nucleotide sequence complexity filtering",
"help_text":"Turns on sequencing complexity filtering. Complexity filtering can be useful to increase run-time by removing unspecific read sequences that do not provide any informative taxon ID."
"description":"Specify the minimum sequence entropy level for complexity filtering",
"help_text":"Specify the minimum 'entropy' value for complexity filtering for BBDuk or PRINSEQ++.\n\nNote that this value will only be used for PRINSEQ++ if `--shortread_complexityfilter_prinseqplusplus_mode` is set to `entropy`.\n\nEntropy here corresponds to the amount of sequence variation exists within the read. Higher values correspond to more variety, and thus will likely reslut in more specific matching to a taxon's reference genome. The trade off here is fewer reads (or abundance information) available for having a confident identification.\n\n\n> Modifies tool parameter(s):\n> - BBDuk: `entropy=`\n> - PRINSEQ++: `-lc_entropy`\n\n"
"help_text":"Turn on masking of low-complexity reads (i.e., replacement with `N`) rather than removal.\n\n> Modifies tool parameter(s)\n> - BBDuk: `entropymask=`"
"help_text":"Specify the minimum sequence complexity value for fastp. This value corresponds to the percentage of bases that is different from it's adjacent bases.\n\n> Modifies tool parameter(s):\n> - removed from reads `--complexity_threshold`"
"description":"Specify the minimum dust score for PRINTSEQ++ complexity filtering",
"help_text":"Specify the minimum dust score below which low-complexity reads will be removed. A DUST score is based on how often different tri-nucleotides occur along a read.\n\n> Modifies tool parameter(s):\n> - PRINSEQ++: `--lc_dust`"
"description":"Turns on long read quality control steps (adapter clipping, length filtering etc.)",
"help_text":"Turns on long read quality control steps (adapter clipping, length and/or quality filtering.)\n\nRemoving adapters (if present) is recommend to reduce false-postive hits that may occur from 'dirty' or 'contaminated' reference genomes in a profiling database that contain accidentially incorporated adapter sequences.\n\nLength filtering, and quality filtering can speed up alignment by reducing the number of unspecific reads that need to be aligned."
"help_text":"Skip removal of adapters by Porechop. This can be useful in some cases to speed up run time - particularly when you are running data downloading from public databases such as the ENA/SRA that should already have adapters removed. We recommend that you check your FastQC results this is indeed the case."
"help_text":"Skip removal of quality filtering with Filtlong. This will skip length, percent reads, and target bases filtering (see other `--longread_qc_qualityfilter_*` parameters)."
"help_text":"Specify the minimum of length of reads to be kept for downstream analysis.\n\n> Modifies tool parameter(s):\n> - Filtlong: `--min_length`"
"description":"Specify the percent of high-quality bases to be retained",
"fa_icon":"fas fa-percentage",
"help_text":"Throw out the remaining percentage of reads outside the value. This is measured by bp, not by read count. So this option throws out the worst e.g. 10% of read bases if the parameter is set to `90`. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
"description":"Specify the number of high-quality bases in the library to be retained",
"fa_icon":"fas fa-bullseye",
"help_text":"Removes the worst reads until only the specified value of bases remain, useful for very large read sets. If the input read set is less than the specified value, this setting will have no effect. _Modified from [Filtlong documentation](https://github.com/rrwick/Filtlong)_\n\n> Modifies tool parameter(s):\n> - Filtlong: `--keep_percent`"
"help_text":"Turns on the ability to remove short-reads from the that derived from a known organism, using Bowtie2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
"help_text":"Turns on the ability to remove long-reads from the that derived from a known organism, using minimap2 and samtools\n\nThis subworkflow is useful to remove reads that may come from a host, or a known contamination like the human reference genome. Human DNA contamination of (microbial) reference genomes is well known, so removal of these prior profiling both reduces the risks of false positives, and in _some cases_ a faster runtime (as less reads need to be profiled).\n\nAlternatively, you can include the reference genome within your profiling databases and can turn off this subworkflow, with the trade off of a larger taxonomic profiling database."
"help_text":"Specify a path to the FASTA file (optionally gzipped) of the reference genome of the organism to be removed.\n\nIf you have two or more host organisms or contaminants you wish to remove, you can concatenate the FASTAs of the different taxa into a single one to provide to the pipeline."
"help_text":"Specify the path to a _directory_ containing pre-made Bowtie2 reference index files (i.e. the directory containing `.bt1`, `.bt2` files etc.). These should sit in the same directory alongside the the reference file specified in `--hostremoval_reference`.\n\nSpecifying premade indices can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
"description":"Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference",
"help_text":"Specify path to a pre-made Minimap2 index file (.mmi) of the host removal reference file given to `--hostremoval_reference`.\n\nSpecifying a premade index file can speed up runtime of the host-removal step, however if not supplied the pipeline will generate the indices for you."
"help_text":"Save the output files of the in-built indexing of the host genome.\n\nThis is recommend to be turned on if you plan to use the same reference genome multiple times, as supplying the directory or file to `--shortread_hostremoval_index` or `--longread_hostremoval_index` respectively can speed up runtime of future runs. Once generated, we recommend you place this file _outside_ of your run results directory in a central 'cache' directory you and others using your machine can access and supply to the pipeline."
"description":"Save mapped reads in BAM format from host removal",
"help_text":"Save the reads mapped to the reference genome in BAM format as output by the respective hostremoval alignment tool.\n\nThis can be useful if you wish to perform other analyses on the host organism (such as host-microbe interaction), however, you should consider whether the default mapping parameters of Bowtie2 (short-read) or minimap2 (long-read) are optimised to your context. "
"description":"Save unmapped reads in FASTQ format from host removal",
"help_text":"Save the unreads mapped to the reference genome in FASTQ format (as exported from `samtools view`).\n\nThis can be useful if you wish to perform other analyses on the off-target reads from the host mapping, such as manual profiling or _de novo_ assembly."
"help_text":"Turns on the concatenation of sequencing runs or libraries with the same sample name.\n\nThis can be useful to ensure you get a single profile per sample, rather than one profile per run or library. Note that in some cases comparing profiles of independent _libraries_ may be useful, so this parameter may not always be suitable. "
"help_text":"DIAMOND can produce output in a number of different formats, you can specify here which to produce.\n\nNote that DIAMOND can only produce one format at a time, and depending on which you pick, some downstream steps may not be executed. For example, selecting `daa` or `sam` will mean you will not get a tabular taxonomic profile as with the other tools.\n\nWill be overriden by `--diamond_save_reads.`\n\n> Modifies tool parameter(s):\n> - diamond blastx: `--outfmt`"
"description":"Turn on saving of DIAMOND-aligned reads. Will override --diamond_output_format and no taxon tables will be generated",
"help_text":"Save aligned reads in SAM format from alignment step of DIAMOND in your output results directory.\n\nNote this explicitly overrides `--diamond_output_format` to produce the SAM file, and no taxon table will be generated.\n\n> Modifies tool parameter(s):\n> - DIAMOND: `--outfmt`"
"help_text":"Specify the taxonomic level(s) to be displayed in the resulting Kaiju taxon table, as generated by the kaiju2table helper tool.\n\nThis can be either a single level (e.g. `species`), or a comma separated list to display the full taxonomic path (e.g. `superkingdom,phylum,class,order,family,genus,species.`).\n\n> Modifies tool parameter(s):\n> - kaiju2table: `-l`"
"description":"Turn on saving of Kraken2-aligned reads",
"help_text":"Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - kraken2: `--classified-out` and `--unclassified-out`"
"description":"Turn on saving of Kraken2 per-read taxonomic assignment file",
"help_text":"Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - kraken2: `--output`"
"description":"Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.",
"fa_icon":"fas fa-save",
"help_text":"Turn on saving minimizer information in the kraken2 report thus increasing to an eight column layout.\n\nAdds `--report-minimizer-data` to the kraken2 command."
"description":"Turn on saving of KrakenUniq-aligned reads",
"help_text":"Save reads that do and do not have a taxonomic classification in your output results directory in FASTQ format.\n\n> Modifies tool parameter(s):\n> - krakenuniq: `--classified-out` and `--unclassified-out`"
"description":"Specify how large to chunk database when loading into memory for KrakenUniq",
"fa_icon":"fas fa-database",
"help_text":"nf-core/taxprofiler utilises a 'low memory' option for KrakenUniq that can reduce the amount of RAM the process requires using the `--preloaded` option.\n\nA further extension to this option is that you can specify how large each chunk of the database should be that gets loaded into memory at any one time. You can specify the amount of RAM to chunk the database to with this parameter, and is particularly useful for people with limited computational resources.\n\nMore information about this parameter can be seen [here](https://github.com/fbreitwieser/krakenuniq/blob/master/README.md#new-release-v07).\n\n> Modifies KrakenUniq parameter: --preload\n\n> \n\n"
"description":"Turn on saving of KrakenUniq per-read taxonomic assignment file",
"help_text":"Save a text file that contains a list of each read that had a taxonomic assignment, with information on specific taxonomic taxonomic assignment that that read recieved.\n\n> Modifies tool parameter(s):\n> - krakenuniq: `--output`"
"description":"Specify which MALT alignment mode to use",
"help_text":"Specify which version of MALT alignment to use.\n\nBlastN is generally recommended (nucleotide-nucleotide alignment), but particularly for very short reads (such as aDNA), whereas BlastX mode is similar to DIAMOND and will translate the nucleotide to amino acid sequences. Note each type of alignment mode requires different parameters during database construction. Refer to the MALT manual for more information.\n\n> Modifies tool parameter(s):\n> - malt-run: `-mode` "
"help_text":"Turns on saving of MALT aligned reads in SAM format.\n\nNote that the SAM format produce by MALT is not completely valid, and may not work with downstream tools.\n\n> Modifies tool parameter(s):\n> - malt-run: `--alignments`, `-za`"
"help_text":"Turns on saving of MALT output in an additional MEGAN summary file (`.megan`) that can be loaded into the MEGAN metagenomic exploration tool.\n\nNote: this file is generated not directly from MALT but rather then MEGAN utility script `rma2info`.\n\n> Modifies tool parameter(s):\n> - rma2info: `-es`"
"help_text":"Turns on standardisation of output OTU tables across all tools; each into a TSV format following the following scheme:\n\n|TAXON | SAMPLE_A | SAMPLE_B |\n|-------------|----------------|-----------------|\n| taxon_a | 32 | 123 |\n| taxon_b | 1 | 5 |\n\nThis currently only is generated for mOTUs."
"description":"Turn on generation of BIOM output (currently only applies to mOTUs)",
"help_text":"Turn on the saving of the taxonomic output in BIOM format (`.biom`) in the results directory of your pipeline run, instead of the default TSV format.\n\nNote this file is from the output of the `motus merge` command.\n\n> Modifies tool parameter(s):\n> - `-B -o`"
"description":"Turn on generation of Krona plots for supported profilers",
"help_text":"Turn on the generation of Krona interactive pie-chart HTMLs for a selection of profilers.\n\nThe tools currently supported are:\n\n- centrifuge\n- kraken2\n- kaiju\n- MALT"
"description":"Specify path to krona taxonomy directories (required for MALT krona plots)",
"help_text":"Specify a path to a Krona taxonomy database directory (i.e. a directory containing a krona generated `.tab` file).\n\nThis is only required for generating Krona plots of MALT output.\n\nNote this taxonomy database must be downloaded and generated with the `updateTaxonomy.sh` script from the krona-tools package."
"description":"Parameters used to describe centralised config profiles. These should not be edited.",
"help_text":"The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
"properties":{
"custom_config_version":{
"type":"string",
"description":"Git commit id for Institutional configs.",
"default":"master",
"hidden":true,
"fa_icon":"fas fa-users-cog"
},
"custom_config_base":{
"type":"string",
"description":"Base directory for Institutional configs.",
"help_text":"If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
"description":"Set the top limit for requested resources for any single job.",
"help_text":"If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
"properties":{
"max_cpus":{
"type":"integer",
"description":"Maximum number of CPUs that can be requested for any single job.",
"default":16,
"fa_icon":"fas fa-microchip",
"hidden":true,
"help_text":"Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
},
"max_memory":{
"type":"string",
"description":"Maximum amount of memory that can be requested for any single job.",
"default":"128.GB",
"fa_icon":"fas fa-memory",
"pattern":"^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
"hidden":true,
"help_text":"Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
},
"max_time":{
"type":"string",
"description":"Maximum amount of time that can be requested for any single job.",
"default":"240.h",
"fa_icon":"far fa-clock",
"pattern":"^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
"hidden":true,
"help_text":"Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
}
}
},
"generic_options":{
"title":"Generic options",
"type":"object",
"fa_icon":"fas fa-file-import",
"description":"Less common options for the pipeline, typically set in a config file.",
"help_text":"These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
"description":"Method used to save pipeline results to output directory.",
"help_text":"The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
"description":"Directory to keep pipeline Nextflow logs and reports.",
"default":"${params.outdir}/pipeline_info",
"fa_icon":"fas fa-cogs",
"hidden":true
},
"validate_params":{
"type":"boolean",
"description":"Boolean whether to validate parameters against the schema at runtime",
"default":true,
"fa_icon":"fas fa-check-square",
"hidden":true
},
"show_hidden_params":{
"type":"boolean",
"fa_icon":"far fa-eye-slash",
"description":"Show all params when using `--help`",
"hidden":true,
"help_text":"By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
},
"enable_conda":{
"type":"boolean",
"description":"Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
"help_text":"If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. `--genome GRCh38`. \n\nSee the [nf-core website docs](https://nf-co.re/usage/reference_genomes) for more details.",
"description":"Do not load the iGenomes reference config.",
"fa_icon":"fas fa-ban",
"hidden":true,
"help_text":"Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
